1. Joanna Klein March 22, 2012

2. Sabbatical Activities Science Research Institute - Administration and Program Development Collaboration with Department of Energy Joint Genome Institute Investigator in their interpret a genome for education program Presented at the American Society for Microbiology Conference for Undergraduate Education Bonus Ventures Blended Learning Course Design Writing project with Boyd Seevers Service to community Service to department and college

4. A collaboration between Northwestern College and Concordia University-St. Paul

5. The Science Research Institute (SRI) is a year long program partnering college science and math majors and high school students with an interest in Science, Engineering, Technology and Math (STEM) areas with the purpose of developing their knowledge and skills in scientific study and research.

6. 5 week Summer program (July 5- August 5, 2011) 32 high school students, 8 College students, 3 high school teachers, 4 college faculty – split between NWC and CSP NWC Research projects Dale Gentry – field biology and ecology Joanna Klein - microbiology CSP Research projects Vivian Feng (Augsburg) - chemistry Jonathan Zderad - statistics

7. Academic Year Program Research Symposium Presentations at Mpls. and St. Paul high schools Service project – Elementary School Science Night Science Museum trip 3M tour College admissions information session Banquet 2011-2012 Program

8. SRI - Sabbatical Activities Research Attended ASM/NIGMS Learning Interventions Institute: Understanding Research Techniques to Study Student Interventions Washington D.C., January 2011 Learned techniques to research best practices in STEM student learning and persistence Research design and methodology Statistical analysis Logic Models Goal: Use SRI as a subject to answer the question how do students who are traditionally underrepresented in the sciences advance in scientific fields?

9. SRI Logic Model Situation Objective of program is to increase high school students persistence in stem and to aid in diversifying stem. Inputs Outputs Outcomes/Impact Need for science and math in the community/work force. Need for education. Need for diversity in Stem education. Political factors. Funding factors. Research Needs. External Factors Professors will want to continue to work on modules. Need for the program will continue. Need for diversity in Stem field. Need for growth of Stem field. Assumptions Long Term Goals: Students choose to go to college. Students choose a major in the Stem field. Students pursue a career in the Stem field. Integrate diversity in the field of science and math. Hinder the under- representation of people of color in the field of science and math. Help community improve to provide a more knowledgeable and skilled work force. Staffing Time Money/ funding Research Base Technology Materials/ Resources College mentor help High school teacher help Number of modules completed Knowledge gained on pre/post data Time (hours) spent on projects Number of presentations conducted as a result of module research Number of Service learning projects completed Amount of research obtained from the modules Number of hours spent mentoring high school students. Number of students in program cycle Short Term Goals: Improving knowledge from pre- post tests for each module. Leadership development among college mentors. Increase in Student Learning. Increasing motivation to take science and math classes. Increase interest in college. Increase interest in stem careers. Increase presentation skills among High school students.

10. SRI Co-Directors Dr. Joanna Klein, NWC & Dr. Shellie Kieke, CSP

11. SRI - Sabbatical Activities, con’t. Program Development Networking MN STEM network Attended annual meeting at Boston Scientific and presented poster Breakthrough St. Paul Developed and supervised course for high school teacher participant – Research as Pedagogy

12. SRI - Sabbatical Activities, con’t. General administration Developed SRI page for NWC websiteSRI page Attended helped coordinate academic year events Medtronic tour Snail Lake Restoration volunteer Science fair service project Be the Match drive Planned and carried out 2011-2012 program Recruited, hired and paid participants Taught in summer program Incorporated new research project

13. Beyond the sabbatical Continue to partner with the NWC grant office to write to foundations for continued support Over $400,000 in support over the past 6 years Worked with Master of Applied Psychology student intern from UW-Stout to develop a Logic Model and evaluation plan for SRI. Currently planning for 2012-2013 program

14. Undergraduate Research in Microbial Genome Analysis http://www.jgi.doe.gov/education/genomeannotation. html http://www.jgi.doe.gov/education/genomeannotation. html Students and instructors across the country partner with the JGI in analysis of microbial genomes to: provide a research-based approach to teach fundamental concepts in the life-science curriculum advance our understanding of diverse microbes

15. Genomics and Bioinformatics Genome sequencing has revolutionized our understanding of microorganisms and the role they play in important processes pathogenesis energy production bioremediation global nutrient cycles origins, evolution, and diversity of life. Currently, there are more than 3000 complete or nearly complete genome sequences of microbes available.

16. Phylogenetic tree of Bacteria Handelsman (2004) Microbiol. Mol. Biol. Rev. 68: 669-685. The problem: genome sequences from members of those phyla in yellow and orange are under- represented relative to those in red

17. Genomic Encyclopedia of Bacteria and Archaea (GEBA) goal is to sequence genomes from under- represented phyla GEBA organisms https://docs.google.com/View?id=dggwdv6s_2d9zhwf9f

18. Genome Projects Determine the genome sequence Annotate genome: Process of attaching biological information to sequences Study function of genes

19. CTCTAACGCGCAAGCGCATATCCTTCTAGGTAGCGGGCAGTAGCCGCTTCAGGGAGGGACGAAGAGACCC AGCAACCCACAGAGTTGAGAAATTTGACTGGCATTCAAGCTGTCCAATCAATAGCTGCCGCTGAAGGGTG GGGCTGGATGGCGTAAGCTACAGCTGAAGGAAGAACGTGAGCACGAGGCACTGAGGTGATTGGCTGAAGG CACTTCCGTTGAGCATCTAGACGTTTCCTTGGCTCTTCTGGCGCCAAAATGTCGTTCGTGGCAGGGGTTA TTCGGCGGCTGGACGAGACAGTGGTGAACCGCATCGCGGCGGGGGAAGTTATCCAGCGGCCAGCTAATGC TATCAAAGAGATGATTGAGAACTGGTACGGAGGGAGTCGAGCCGGGCTCACTTAAGGGCTACGACTTAAC GGGCCGCGTCACTCAATGGCGCGGACACGCCTCTTTGCCCGGGCAGAGGCATGTACAGCGCATGCCCACA ACGGCGGAGGCCGCCGGGTTCCCTGACGTGCCAGTCAGGCCTTCTCCTTTTCCGCAGACCGTGTGTTTCT TTACCGCTCTCCCCCGAGACCTTTTAAGGGTTGTTTGGAGTGTAAGTGGAGGAATATACGTAGTGTTGTC TTAATGGTACCGTTAACTAAGTAAGGAAGCCACTTAATTTAAAATTATGTATGCAGAACATGCGAAGTTA AAAGATGTATAAAAGCTTAAGATGGGGAGAAAAACCTTTTTTCAGAGGGTACTGTGTTACTGTTTTCTTG CTTTTCATTCATTCCAGAAATCATCTGTTCACATCCAAAGGCACAATTCATTTTGAGTTTCTTTCAAAAC AAATCGTTTGTAGTTTTAGGACAGGCTGATGCACTTTGGGCTTGACTTCTGATTACCCTATTGTTAAATT AGTGACCCCTCTTAGTGTTTTCCTGTCCTTTATTTCGGAGGACGCACTTCGAAGATACCAGATTTTATGG GTCATCCTTGGATTTTGAAGCTTATAACTGTGACAAAAAATGTGAAGGGAAGAGATTTGAAACATGTGGA AGGAAAAGTGAGTGCAGACTATAAACTTCCAAAAAGACAAGCCCAAAATACACCTAAACGTTATGTCAGA TTATTTTGTTAAAATCAGTTGTTAGTGACGTCCGTACGTTAATAGAAAAAAGAATGCTTCAGTTTGGAGT GGTAGGTTTCTAGAGGGATTTATTGTGAAAGTATAAACTATTCAGGGCAATGGGACTGAGAGAACAGTGG GTAGAAAGGACCACTGAAGGAAAGGAAGAGAATTGGAAGGTAGATGAAAGAAGGAGCAAGAACCTGGGGA TGTTTTTTCCTTTTCACTTGTAATAGTAGTAACAGAAGCAATGGCAGACTGGCTTTTGTTTCTACTGTGT TAGAATGAATTGACAGGACAACTGGGCCTATTATTGTACTGTGCCAGAATACTGTAAAACAAAACTAAAC ATACTAGCTTGGTGGCTTGTAATTAATTACTTAAGTGGAGATTTTTATTTTTTTTTTATTTTTTTTTTAG ACGGAGTCTCACTTTGTCACCCAGGCTGGAGTGCAGTGGCGCGATCTCAGCTGACTGCAACCTCCTCCTC ACAGGTTCAAGGGAGATTCTCCTGCCTCAGCCTCCCGAGTAGCTAGGACTATAGGCATGTGCCACCACAC CTGGCTAATTTTGTATTTTTAGTAGAGATGGGATTTCTCCATGTTGGTCAGGCTGGTGTCAAAACTCTCG ATCTCAGGTGAACCGCCTGCCTCAGCCTTCCAAAGTGCTGGGATTACAGGCGTGAGCCACCGCGCCCTGC AGTTTTTTGTATTTTTAATAGAGACAGGGTTTCACCATGTTAGCCAGGATGGTCTCGATTTCCTGACCTC AGGTGATCTGCCCGCTTTGGCCTCCCAAAGTGCTGGGATTACAAGCATGAGCCACCGCGCCCGGCTCAAG

20. Bacterial Luciferase

21. Process of annotation Done automatically using computer software Manual annotation is best 35% of computer generated annotations are wrong or are missing information. Limitation of computer algorithms Draw backs: Labor intensive and time consuming

22. Manual Annotation IMG-ACT is a toolkit of online gene and genome analysis programs. Using IMG-ACT, students annotate genomes provide human expertise necessary for accurate, up-to-date, reliable annotation Students contribute to the scientific community and learn biological concepts through participating in original research

23. JGI Genome Annotation Workshop Walnut Creek, CA, Jan. 2011

25. Genomic Encyclopedia of Bacteria and Archeae https://docs.google.com/View?id=dggwdv6s_2d9zhwf 9f https://docs.google.com/View?id=dggwdv6s_2d9zhwf 9f Northwestern College has adopted the genome of Cellulophaga lytica to study

26. Marine bacterium Isolated from beach mud near Limon, Costa Rica in 1969 Member of the Cytophaga- Flavobacterium- Bacteroides (CFB) group Poorly characterized branch of the tree of life Has the ability to degrade cellulose Biofuel research http://www.infoplease.com/atlas/centralamerica.html Cellulophaga lytica http://travel.yahoo.com/p-travelguide-482616- limon_vacations-i

27. Cellulophaga lytica Gram negative Filamentous Exhibits gliding motility Yellow pigmentation

28. H:\JGI IMG_ACT\C. lytica\Photos\C. lytica 63X video in water fast\C. lytica 63X video in water fast_t01.MOV H:\JGI IMG_ACT\C. lytica\Photos\C. lytica 63X video in water fast\C. lytica 63X video in water fast_t01.MOV

29. Beyond the Sabbatical Incorporated IMG-ACT into teaching and research SRI, Summer 2011 Genetics, Fall 2011 Microbiology, Spring 2012 Principles of Biology 2, Spring 2012 Research Students: Stephen Erickson and Andy Jaeger Networking St. Thomas, St. John’s/St. Ben’s, Gustavus, U of MN, UN- Lincoln, St. Cloud, JGI

30. ASM Conference for Undergraduate Educators Johns Hopkins University, June 2011 Is it E. coli O157:H7? Using Bioinformatics to Develop and Test Hypotheses manuscript submitted to Journal of Microbiology and Biology Education Leading an Elementary School Science Club: A Service Learning Project for Microbiology Students

31. New Blended Learning Course Development

32. Writing Project GENETICS AND THE BIBLE: THE CURIOUS CASE OF THE LEFT-HANDED BENJAMITES Boyd Seevers, Ph.D.; Joanna Klein, Ph.D.

33. Service to Community Volunteer with science program at Island Lake Elementary Member of organizing committee Organized help sessions for students working on science fair projects Organized DNA activity for families Interviewed students Recruited NWC college student volunteers for all of the above activities

34. Service to the Department and College Department Tri-Beta advisor Continued to advise, attend dept. meetings and events Taught a session of Senior Seminar and Microbiology Lab Assessment Committee ePortfolio sub-committee Advising sub-committee

35. Acknowledgements Thank you to Northwestern College for providing the opportunity and support. Funding received from Faculty Development Grant and SRI grants