1. Essential Basic Part Types Coding Sequences (C) - Complete open reading frames (type I), or sequences encoding polypeptides but lacking either a stop codon (type II), a start codon (type III), or both (type IV) Ribosome Binding Sites (RBS) - Sequence encoding a ribosome binding site, fused 5' to an ORF part Terminators (TT) - Sequence causing transcription termination (and more can come later, with their own part definitions and standards rules)

2. Potter Standard Polylinker AGATCTPARTSEQUENCE1GGATCC AGATCTPARTSEQUENCE2GGATCC GlySer AGATCTPARTSEQUENCE1GGATCTPARTSEQUENCE2GGATCC GAATTCaaaAGATCTPARTSEQUENCE1GGATCCaaaCTCGAG

3. Type I Coding Sequences AGATCTATG_MIDDLE_OF_PART_TAAGGATCC AGATCTGTG_MIDDLE_OF_PART_TGAGGATCC  The start and stop codons are placed directly adjacent to the BglII and BamHI sites, respectively  Start codons are free to be ATG, CTG, TTG, or GTG

4. Coding Sequences Type II AGATCTATGAAATTTCCCGGGAAATTTGGATCC Type III AGATCTCATCATCATCATCATCATTAAGGATCC Type IV AGATCTAAATTTCCCGGGAAATTTCCCGGATCC  Coding sequences allow the construction of ORF fusions for chimeric and tagged proteins. GlySer scars separate junctions between fused peptides.

5. Ribosome Binding Sites AGATCTGAAAGAGGAGAAAGGATCC  The spacing of a ribosome binding site relative to the start codon is fixed. Shown is a (likely) strong RBS AGATCTATG_ORF_Part_TAAGGATCC.RBS. AGATCTGAAAGAGGAGAAAGGATCTATG_ORF_Part_TAAGGATCC

6. Promoters +1 | AGATCTTCC_Middle_of_Ptet_TAGAGATACTGAGCACGGATCC  The transcriptional start site (+1) is located at the position directly 5' to the BamHI site (whenever possible)

7. Terminators...CUUUCUGCGUUUAUA3' | AGATCTCCA_Middle_of_Ptet_CTTTCTGCGTTTATAGGATCC  The transcriptional termination site is located at the position directly 5' to the BamHI site (whenever possible)