1. Using a Codon Chart & Mutations Today’s Goal: Review codons and anticodons and describe several types of mutations. Quiz tomorrow over ch 12 and 13 material If good understanding of codon chart start with slide 5

3. What do these codons code for? 1.UUA = ? 2.AAG=? 3.UUG=?

4. DNA to Amino Acid Sequence DNA:TACACACGAGGAGGGTCTAAAATT mRNA: tRNA: Amino acids:

5. Mutations A mutation is a change in structure of amount of genetic material of an organism. Genetic material is different from previous. A small change in DNA may affect an amino acid in the protein. There maybe no, a positive effect, or a negative effect from a mutation.

6. Mutagens Chemical / physical agents in the environmental that cause mutations. – No/little effect – Beneficial- “polyploidy” in plants to make stronger, or adjust to changing environment – Negatively- sickle cell disease

7. Types of mutations 1. Point – single nucleotide changes Gene Mutations: single gene – No mutation ATGCCATCG Metproser – Silent mutation ATGCCTTCG Met ProSer – Missense mutation ATGCAATCG MetGlnSer – Nonsense mutation ATCCCATCG STOP

8. Chromosomal mutations: #/structure 2. Insertion – extra nucleotides are added 3. Deletion – nucleotides are removed – No mutation ATG CCA TCG Met Pro Ser – Frameshift mutation ATG GCC ATC G Met Ala Ile

9. Gene Mutations: Deletion, insertion, substitution Which 2 lead to a frameshift?

10. Other Chromosomal Mutations Original Deletion OriginalInversion OriginalTranslocation OriginalDuplication AB C DE F AB C DE F AB C DE F AB C DE F A C DE F AED CB F ABC J K LDEF ABB DE F C

11. Which of the following mutations would cause a more serious effect in the coding of UUG? a)UUA b)CUA c)UAA