1. Introductory Genetics http://www.stats.gla.ac.uk/~paulj/intro_genetics.ppt

2. How genes work

3. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule (usually a protein) DNA Protein …GAATTCTAATCTCCCTCTC AACCCTACAGTCACCCATTT GGTATATTAAAGATGTGTTG TCTACTGTCTAGTATCC… mRNA

4. Genes are located in the cell nucleus on chromosomes Karyotype

5. Down syndrome karyotype (trisomy 21)

6. DNA (deoxyribonucleic acid) mRNA Protein

8. Transcription movie

9. Translation

12. Translation movie

13. Gene expression movie

14. Summary A gene is a length of DNA that contains instructions for making a specific protein Genes are arranged along 23 pairs of chromosomes in the cell nucleus Genes work by specifying the amino acid sequence of a protein

15. Mendel’s laws

16. Genetic knowledge used for 1000s of years: agriculture

17. Patterns of disease inheritance known for 1000s of years, e.g. haemophilia

18. Mendel deduced the underlying principles of genetics from these patterns 1.Segregation 2.Dominance 3.Independent assortment

19. Mendel’s experiments

20. Mendel’s data

21. Mendel’s law of segregation A normal (somatic) cell has two variants (alleles) for a Mendelian trait. A gamete (sperm, egg, pollen, ovule) contains one allele, randomly chosen from the two somatic alleles. E.g. if you have one allele for brown eyes (B) and one for blue eyes (b), somatic cells have Bb and each gamete will carry one of B or b chosen randomly. Bb BBBBb b bb Eggs Sperm

22. Mendel’s law of dominance If your two alleles are different (heterozygous, e.g. Bb), the trait associated with only one of these will be visible (dominant) while the other will be hidden (recessive). E.g. B is dominant, b is recessive. Bb BBBBb b bb Eggs Sperm

23. Mendel’s law of dominance If your two alleles are different (heterozygous, e.g. Bb), the trait associated with only one of these will be visible (dominant) while the other will be hidden (recessive). E.g. B is dominant, b is recessive. Bb BBBBb b bb Eggs Sperm

24. Terminology… Haploid: containing one copy of each chromosome (n=23) Bb BBBBb b bb Eggs Sperm Diploid: containing two copies of each chromosome (2n=46)

25. Terminology… Genotype: the states of the two alleles at one or more locus associated with a trait Phenotype: the state of the observable trait GenotypePhenotype BB (homozygous)Brown eyes Bb (heterozygous)Brown eyes bb (homozygous)Blue eyes

26. Mendel’s law of independent assortment Knowledge of which allele has been inherited at one locus gives no information on the allele has been inherited at the other locus S/sY/y SYSySysYsYsy 25%

27. Mendel’s law of independent assortment SY sy Gametophytes (gamete- producing cells) SY sy Gametes Ab aB Recombinants Segregation

28. Mendel’s law of independent assortment SY sy Gametophytes (gamete- producing cells) SY sy Gametes Sy sY Recombinants Recombination Segregation

29. Simplified view of eye colour inheritance: biallelic Mendelian trait –Brown dominant: BB, Bb –Blue recessive: bb Human eye colour Bb BBBBb b bb Eggs Sperm

30. Human eye colour ?

31. ? B? bb B?

32. Human eye colour ? Bb B?bb B?

33. Human eye colour ? Bb B?

34. Human eye colour ? Bb P(BB)=1/3 Bb P(Bb)=2/3

35. Human eye colour ? Bb P(BB)=1/3 Bb P(Bb)=2/3 P(b)=2/3x1/2=1/3P(b)=1/2

36. Human eye colour ? Bb P(BB)=1/3 Bb P(Bb)=2/3 P(b)=2/3x1/2=1/3P(b)=1/2 P(bb)=1/3x1/2=1/6

37. Haemophilia A Males with a mutant gene are affected Females with one mutant gene are unaffected carriers Non-Mendelian inheritance: Haemophilia

38. Non-Mendelian inheritance: additive traits Brown eye colour is dominant

39. Non-Mendelian inheritance: additive traits Snapdragon red colour is additive

40. Non-Mendelian inheritance: polygenic traits

41. For example, height