1. Chapter 4 Molecular Cloning Methods Jay D. Hunt, Ph.D. Department of Biochemistry and Molecular Biology CSRB 4D1 568-4734 jhunt@lsuhsc.edu

2. I. Restriction Endonucleases

3. Restriction endonucleases –Restriction - Bacterial encoded restriction endonucleases restrict bacteriophages to only one host strain. –Endonuclease - Restriction endonucleases cleave nucleic acids in the middle.

4. Subclasses of restriction endonucleases: –Type I - Recognize specific sequences and cleave DNA at a nonspecific site > than 1,000 bp away –Type II - Recognize palindromic sequences and cleave within the palindrome –Type III - Recognize specific 5-7 bp sequences and cleave 24-27 bp down stream of the site. Type II restriction endonucleases are the most useful class, as they recognize specific palindromic sequences in DNA and cleave the phospodiester bonds in the ribose backbone within the palindrome

5. A palindrome is anything that reads the same forwards and backwards: –Mom –Dad –Tarzan raised Desi Arnaz rat. –Able was I ere I saw Elba –Doc note I dissent, a fast never prevents a fatness; I diet on cod. –Do good? I? No! Evil anon I deliver. I maim nine more hero-men in Saginaw, sanitary sword a-tuck, Carol, I–lo– rack, cut a drowsy rat in Aswan. I gas nine more hero- men in Miami. Reviled, I (Nona) live on. I do, O God!

6. In DNA, palindromes are defined as double stranded DNA that reads the same 5’ to 3’ The EcoRI cutting site: – 5'-GAATTC-3' – 3'-CTTAAG-5' The HindIII cutting site: – 5'-AAGCTT-3' – 3'-TTCGAA-5' Types of recognition sites: 4 bp 6 bp 8 bp 4 4 = 256 bp 4 6 = 4,096 bp 4 8 = 65,536 bp

7. Table 4.1

8. Figure 4.1

9. Type II restriction endonucleases cut only at specific palindromic sites; therefore, “sticky ends” result from DNA cleavage. Fragments of DNA cut with the same enzyme will hybridize to these sticky ends.

10. Always indicate 5’ and 3’ ends of BOTH strands. 3'CTTAAG5' 3'CTTAA5' 3'G5' 5'GGATCC3' 3'CCTAGG5' 5'G3' 5'GATCC3' 3'CCTAG5 3'G5' Eco RI Bam HI 5'GAATTC3'5'G3' 5'AATTC3' HindIII 5'AAGCTT3' 3'TTCGAA5' 5'A3' 5'AGCTT3' 3'TTCGA5' 3'A5' 5’ overhang 5'GATATC3' 3'CTATAG5' 5'GAT3' 5'ATC3' 3'CTA5' 3'TAG5' EcoRV Blunt end 3'GACGTC5'3'G5' 3'ACGTC5' 5'CTGCAG3'5'CTGCA3' 5'G3' Pst I 3’ overhang

11. I.Restriction Endonucleases II.Cloning

12. GAATTC CTTAAG GAATTC CTTAAG Cloning G CTTAA AATTC G Digest with EcoRI G CTTAA AATTC G Hybridize GAATTC CTTAAG Ligation

14. Text Art Page 62

16. Figure 4.2

17. Figure 4.3 Origin of replication At least one unique restriction site A selectable marker

18. Figure 4.4

19. Figure 4.5

20. Figure 4.6 Multicloning site  -peptide of  -galactosidase

21. DNA fragment up to 5 KB can insert ori p

22.  -peptide of  -galactosidase is encoded by lacZ NH 2 -terminal portion lacZ is disrupted by insert  -peptide is carried in genetically modified bacterial strains. COOH-terminal portion  -complementation occurs. 5-bromo-4-chloro-3-indolyl-  - D - Galactopyranoside (X-gal) is metabolized resulting in blue colonies No  -complementation occurs. White colonies

23. Figure 4.7b Addition of ligase would cause this to seal Without phosphate group, ligation cannot occur Phosphates are donated by the insert Ligation occurs

24. Figure 4.7a Note that the phosphate group is required for ligation to occur.

25. EcoRI Kpn I pUC18 lacZ MCS Sst I EcoRI Kpn I Sma I/Xma I BamHI Xba I Sal I/Acc I Hinc II Pst I Sph I HindIII

26. EcoRI Kpn I Sst I EcoRI Kpn I Sma I/Xma I BamHI Xba I Sal I/Acc I Hinc II Pst I Sph I HindIII 5'-G AATTC-3' 3'-CTTAA G-5' Digestion with EcoRI 5'-G C-3' 3'-CTTAA CATGG-5' Digestion with EcoRI & Kpn I

27. EcoRI Kpn I Sst I EcoRI Kpn I Sma I/Xma I BamHI Xba I Sal I/Acc I Hinc II Pst I Sph I HindIII Digest both insert and vector with EcoRI and Kpn I EcoRI Kpn I

28. Figure 4.8 Required for lysogenic lifecycle Required for lytic lifecycle (progeny produced) 12 to 20 KB inserts

29. Genomic Library Construction cos sites BamHI 12-20 KB insert BamHI ~4 KB Too short, not viable

30. Sau3A, ~250 bp -GGATCC- -CCTAGG- BamHISau3A -GATC- -CATG- -G -CCTAG GATC- - -GGATC- -CCTAG-

31. Digest with BamHIPartial Digest with Sau3A Isolate pieces 12-20 KB in length Combine Package into phage heads

32. Figure 4.9

33. DNA hybridization

34. Figure 4.10

35. Figure 4.11 40 to 50 KB inserts

36. I.Restriction Endonucleases II.Cloning III.Probes to detect specific clones

37. GGTGGCATGCCGATTCCAGCTAGTCAACCGTACTG CCACCGTACGGCTAAGGTCGATCAGTTGGCATGAC GGTGGCATGCCGATTCCAGCTAGTCAACCGTACTG CCACCGTACGGCTAAGGTCGATCAGTTGGCATGAC Melt GGTGGCATGCCGATTCCAGCTAGTCAACCGTACTG CCACCGTACGGCTAAGGTCGATCAGTTGGCATGAC Probe GCCGATTCCAGCTAGTCAAGG

38. CCACCGTACGGCTAAGGTCGATCAGTTGGCATGAC CCACCGTACAAATAAGTTCAATCAGGGAACATGAC GCCGATTCCAGCTAGTCAAGG Low stringency hybridization Low stringency washing conditions High salt concentration (0.3 M NaCl) Low temperature (20 to 30°C) Low organic solvent concentrations

39. CCACCGTACGGCTAAGGTCGATCAGTTGGCATGAC CCACCGTACAAATAAGTTCAATCAGGGAACATGAC GCCGATTCCAGCTAGTCAAGG Low stringency hybridization High stringency washing conditions Low salt concentration (0.03 M NaCl) High temperature (65°C) High organic solvent concentrations GCCGATTCCAGCTAGTCAAGG

40. I.Restriction Endonucleases II.Cloning III.Probes to detect specific clones IV.PCR

41. Figure 4.12

42. Denaturation (94°C) ++ Annealing (37-65°C) Extension (72°C) TemplatePrimersdNTPs First round complete

43. 94°C 37-65°C72°C Second round complete

44. 1 2 4 8 16 32 64

45. 30 rounds of PCR = 1,073,741,824 (1.07 X 10 9 ) copies 40 rounds of PCR = 1,099,511,628,000 (1.1 X 10 12 ) copies Exponential Increase in Target DNA From 1 copy of template DNA

46. I.Restriction Endonucleases II.Cloning III.Probes to detect specific clones IV.PCR V.cDNA cloning

47. Figure 4.13

48. I.Restriction Endonucleases II.Cloning III.Probes to detect specific clones IV.PCR V.cDNA cloning VI.Labeling DNA with nick translation

49. Figure 4.14

50. I.Restriction Endonucleases II.Cloning III.Probes to detect specific clones IV.PCR V.cDNA cloning VI.Labeling DNA with nick translation VII.Cloning with Reverse Transcriptase-PCR

51. Figure 4.15

52. I.Restriction Endonucleases II.Cloning III.Probes to detect specific clones IV.PCR V.cDNA cloning VI.Labeling DNA with nick translation VII.Cloning with Reverse Transcriptase-PCR VIII.5’ RACE

53. Figure 4.16

54. I.Restriction Endonucleases II.Cloning III.Probes to detect specific clones IV.PCR V.cDNA cloning VI.Labeling DNA with nick translation VII.Cloning with Reverse Transcriptase-PCR VIII.5’ RACE IX.Expression vectors

55. Figure 4.17

56. Figure 4.19a

57. Figure 4.19b

58. Figure 4.20

59. Figure 4.21

60. Figure 4.22