Download presentation
Published byHorace Neal Modified over 9 years ago
1
Isolation and Characterization of the Metallothionein Promoter
in Artemia HHMI Spring 2004 Gwen Jordaan
2
Background metallothionein = MT metal-binding protein
four isoforms identified in mammals: MT-I, MT-II, MT-III and MT-IV diverse functions -metal ion homeostasis -heavy metal sequestration -protection from oxidative damage -metal reservoir HHMI Spring 2004 Gwen Jordaan
3
Metallothionein dumbbell shape, cysteine-rich domain and domain
clusters of metal ions HHMI Spring 2004 Gwen Jordaan
4
Metallothionein Zinc-thiolate clusters Eo very low
Fischer et al., Proc.Natl.Acad.Sci. 1998 Maret, W. Am.Soc.Nutr.Sci 2000 HHMI Spring 2004 Gwen Jordaan
5
Metallothionein Regulation
regulation – transcriptional level induction – metals, oxidants,cytokines, hormones metal induction- metal responsive elements (MREs) MREs- conserved core sequence TGC(G/A)CNC metal transcription factor, MTF-1 regulates expression - binding to MRE - activity induced by metals but needs zinc to bind to MRE HHMI Spring 2004 Gwen Jordaan
6
Metallothionein Regulation
HHMI Spring 2004 Gwen Jordaan
7
Artemia brine shrimp – Artemia salina Nauplius Adult
HHMI Spring 2004 Gwen Jordaan
8
Metallothionein Why Artemia?
small, easy to grow, and relatively cheap to purchase embryonic development extensively studied biomarker for heavy metal contamination in aquatic ecosystems -phthalate ester embryotoxicity four Artemia MT isoforms identified coding region of one of the isoforms sequenced HHMI Spring 2004 Gwen Jordaan
9
Metallothionein Goal: isolate and sequence the promoter region, ID
position and number of MREs, and determine extent of promoter activity when induced by heavy metals - experiment design will determine if four isoforms regulated by one promoter, or if each isoform is regulated by its own promoter HHMI Spring 2004 Gwen Jordaan
10
Metallothionein coding sequence of Artemia MT isoform
5’ATGGACTGCTGCAAGAACGGTTGCACCTGTGCCCCAAATTGCAAATGTGCC Start asp cys cys lys asn gly cys thr cys ala pro asn cys lys cys ala AAAGACTGCAAATGCTGCAAAGGTTGTGAGTGCAAAAGCAACCCAGAATGC lys asp cys lys cys cys lys gly cys glu cys lys ser asp pro glu cys AAATGTGAGAAGAACTGTTCATGCAACTCATGTGGTTGTCACTGA3’ lys cys glu lys asn cys ser cys asn ser cys gly cys his Stop HHMI Spring 2004 Gwen Jordaan
11
Methods and Materials Genomic DNA digested with restriction enzymes
DNA walking method- amplification of an unknown sequence adjacent to a known sequence - touchdown PCR – annealing/extension temperature is higher than Tm of the primers HHMI Spring 2004 Gwen Jordaan
12
Methods and Materials measure fluorescence DNA walking
Clone into vector clone into GFP reporter gene Send for sequencing generate MT promoter- ID MREs GFP constructs transfect into COS cells treat with nM metal concentrations for 24h incubation measure fluorescence HHMI Spring 2004 Gwen Jordaan
13
Methods and Materials MT-GFP constructs showing deletions
MT-GFP vector GFP HHMI Spring 2004 Gwen Jordaan
14
Expected Results induction by Zn greater than Cd
extent of induction decreased as MREs removed HHMI Spring 2004 Gwen Jordaan
15
Future Perspectives 4 promoters for 4 isoforms or 1 promoter for 4 isoforms - expression is tissue-specific - differential expression due to environmental factors cooperative interaction among MREs promoter sequenced other regulatory elements can be identified and studied -ARE/USF – oxidative stress HHMI Spring 2004 Gwen Jordaan
16
Dr Acey (Research Mentor) HHMI Dr Mason (Instructor)
Acknowledgements Dr Acey (Research Mentor) HHMI Dr Mason (Instructor) HHMI Spring 2004 Gwen Jordaan
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.