1. Introduction to Microarrays

2. The Central Dogma

4. Hybridization A A A T T G G C C T A T G A T G C C A A A T T G G C C T A T G A T G C C

5. Introduction to Microarrays

6. Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go CELL RNA

7. Why not Northern? RNA

8. How? gene specific DNA probes labeled target gene mRNA

9. Microarrays - The Technologies Stanford Microarrays Affymetrix

10. Stanford Microarrays Glass slides Deposition of probes Ready-to-use array Hybridization

11. Making Microarrays 1. Produce probes 2. Print by the use of a robot oligos cDNA library PCR products

12. Spotting - Mechanical deposition of probes

13. 16-pin microarrayer

15. Sample preparation 1. Design experiment Question? Replicates? Test? 2. Perform experiment 4. Label RNA Amplification? Direct or indirect? Label? wild type mutant 3. Precipitate RNA Eukaryote/prokaryote? Cell wall?

16. mRNA cDNA Cy3-cDNACy5-cDNA SAMPLE CONTROL Stanford microarrays DESIGN and ORDER PROBES

17. Affymetrix GeneChip ® oligonucleotide array 11 to 20 oligonucleotide probes for each gene On-chip synthesis of 25 mers ~20.000 genes per chip good quality data – low variance

18. Example Catalog Arrays Human Mouse Rat Arabidopsis C. elegans Canine Drosophila E. coli P. aeruginosa Plasmodium/Anopheles Vitis vinifera (Grape) Xenopus laevis Yeast Zebrafish NimbleExpress™ Array Program

19. Fluidic Station and Scanner

20. The Affymetrix Genechip ®

21. TTT T T T T T T T A A A A A A A AAA Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups Mask #1 Mask #2

22. Photolithography - Micromirrors NimbleExpress™ Array Program

23. The Affymetrix GeneChip ® A gene is represented like this: - Perfect Match (PM) - MisMatch (MM) PM MM PM: CGATCAATTGCACTATGTCATTTCT MM: CGATCAATTGCAGTATGTCATTTCT

24. The Technologies - Costs - Flexibility - Data Quality Affymetrix Spotter

25. Facility setup: Stanford Microarrays < 100,000 USD Affymetrix< 250,000 USD The Technologies – Cost Cost pr. array Stanford Microarrays 30-50 USD Affymetrix 300-400 USD NimbleExpress™ Array Program - a bit more expensive

26. The Technologies - Flexibility Stanford microarrays: Are flexible, but new probes must be ordered each time Affymetrix arrays: Are not flexible, unless you order the NimbleExpress™ chip

27. The Technologies - Data Quality Reproducibility of data: (Pearson’s correlation coefficient) Stanford microarrays: 0.80 - 0.95 Affymetrix:  0.95

28. The Technologies - Choice of Stanford microarrays: If you work with unsequenced species Low budget Affymetrix: Only sequenced species High data quality

29. Analysis of Data Normalization: Linear or non-linear Statistical test: student’s t-test ANalysis Of VAriance (ANOVA) Analysis: Principle Component Analysis (PCA) Clustering and visualization

30. Sample Preparation Hybridization Array design Probe design Question Experimental Design Buy Chip/Array Statistical Analysis Fit to Model (time series) Expression Index Calculation Advanced Data Analysis ClusteringPCAClassification Promoter AnalysisRegulatory Network Comparable Gene Expression Data Normalization Image analysis The DNA Array Analysis Pipeline