1. DNA and Beyond 2011PHS Rashmi Pershad

2. Objectives  Learn about the role of DNA sequencing and fragment analysis  Learn how to look up information on any gene of interest  How to conduct a BLAST search  How to go from gene sequence to function  The $1,000 Genome

3. DNA Technologies  Methodology  Fragment Analysis  DNA Sequencing  Real time PCR  Applications:  Medical Diagnostics  Forensic Analysis  Plant Genetics

4. Polymerase Chain Reaction  PCR Movie- Cold Spring Harbor  http://www.dnalc.org/view/15475-The cycles-of-the-polymerase-chain-reaction- PCR-3D-animation-with-no-audio.html http://www.dnalc.org/view/15475-The cycles-of-the-polymerase-chain-reaction- PCR-3D-animation-with-no-audio.html http://www.dnalc.org/view/15475-The cycles-of-the-polymerase-chain-reaction- PCR-3D-animation-with-no-audio.html  PCR Movie Applied Biosystems  http://media.invitrogen.com.edgesuite.net/ ab/applications-technologies/pharma- biotherapeutics/pcr.swf http://media.invitrogen.com.edgesuite.net/ ab/applications-technologies/pharma- biotherapeutics/pcr.swf http://media.invitrogen.com.edgesuite.net/ ab/applications-technologies/pharma- biotherapeutics/pcr.swf

5. Microsatellites  What is a microsatellite?  Are simple sequence repeats consisting of 1-6 base pair repeats  How can they be used?  They can be used as genetic markers

6. 377 gels 96 well porous comb gels Data from 96 lanes in 2.5 hours Still had to track create size standards and analyze data. Study Microsatellite Instability

7. Rox 350 size standard 0.02µl per sample Fiveplex Microsatellite Analysis Fragment Analysis

8. Limitation of Instrumentation In Cancer Center work with precious archival paraffin embedded patient DNA. Increased sensitivity provides more data from limited sample. Too much sample results in pull up Optimal input of product for us is 0.4 ng/µl

10. Dye Primer Labeling And ddNTPS dNTPs A A ACCG A And ddNTPS dNTPs C C ACCG A C G T ACC A G ACCGAC T 4 separate reactions Taq polymerase

11. Dye Terminator labeling Template Primer A AC ACCG ACCGT Advantages Reaction performed in single tube Can used unlabeled primers False stops are undetected Taq polymerase, dNTPs + ddTerminators G T A C

12. linker Fluorescein donor Dye dRhodamine Acceptor dye Acceptor Dyes dR6GA dRoxC dR110G dTamraT Argon Laser Emission spectra 500-600nm CCD Camera filter Raw Data Donor Dye absorbs excitation energy from laser Transfers c.100% to acceptor molecule Big Dye gives 2-3 times brighter signal when incorporated into cycle sequencing product Big Dye Terminators

13. DNA Sequencing Movie  DNA Sequencing Movie- Applied Biosystems  http://media.invitrogen.com.edgesuite.net/ ab/applications-technologies/pharma- biotherapeutics/DNA_sequencing.swf http://media.invitrogen.com.edgesuite.net/ ab/applications-technologies/pharma- biotherapeutics/DNA_sequencing.swf http://media.invitrogen.com.edgesuite.net/ ab/applications-technologies/pharma- biotherapeutics/DNA_sequencing.swf

15. Protocol Set up sequencing reaction in tube. Keep reagents on ice Mix well and spin briefly Sequencing Reaction Protocol ReagentQuantity DNA1.5µl Primer1.6µl Big Dye Terminator ready2µl reaction mix 5X reaction Buffer3µl deionised water11.9µl Total Volume20µl

16. Raw Sequence Data Start of Sequence Read out to 800 bases

17. Standard Template on Pop4 80cm Capillary. Run under standard conditions BDv3.1 ( 1µl)- 800-900 base reads

18. Data from a 3700 in 4hours run

19. Problematic Template on Pop4 80cm Capillary. GC rich template with and without Enhancer A Big dye Version 3.1

20. Normal Wilm’s Tumor Exon 9 MutantC T

21. What do you do once you have a sequence ? Compare it to normal sequence. Submit it to a sequence alignment program to assemble sequence Search database to identify sequence

22. DNA Databases  When a scientist sequences a segment of DNA, be it a single gene, a gene operon or an entire chromosome or GENOME, the sequence is deposited in an online database.  The most commonly used database in this country is NCBI Genbank Other databases include:  EMBL-EBI (European Molecular Biology Laboratory- European Bioinformatics Institute)  DDBJ (DNA Data Bank of Japan)  These databases contains millions of DNA sequences and exchange information daily

23. Bioinformatics Tools BLAST( NCBI TOOL) Sequence Alignment Sequence Comparison Sequence Identification

24. BLAST SEARCH  NCBI allows users to search the databases and perform analyses in various ways.  You can search by name for nucleotide sequences (genes) or amino acid sequences (proteins).  You can search by name for publications about the sequence (recorded in the Science Life literature database called PUBMED).  You can search for similar sequences using the feature called BLAST (by inputting all or part of a DNA or amino acid sequence) and compare two or more sequences.

25. Pub Med  PUBMED is the NCBI database of scientific literature that you can search with terms of interest, to see what researchers have discovered about the biology of proteins that are similar to your query sequence.

27. Reference Material  http://www.pseudomonas- syringae.org/Outreach/Module_4_Web.htm http://www.pseudomonas- syringae.org/Outreach/Module_4_Web.htm http://www.pseudomonas- syringae.org/Outreach/Module_4_Web.htm  http://www.digitalworldbiology.com/BLAST /slide1.html http://www.digitalworldbiology.com/BLAST /slide1.html http://www.digitalworldbiology.com/BLAST /slide1.html

29. Submit Search- Wait Submit Search- Wait

30. New BLAST Format

31. Genomic View

32. BLAST Output

35. NCBI Sequence Record  Each sequence record in the NCBI sequence databases is organized into three sections:  Header – general information about the sequence including the organism it came from and the paper in which it was first published.  Features - information about the role of the sequence in the biology of the organism and any changes that have been made to the sequence. This section also includes information like the length of the sequence, the molecular weight of the protein, and any notes that the depositors wished to add. The start of this section is indicated with the label FEATURES on the left. Terms beginning with a / are referred to as ‘qualifiers’. Examples of qualifiers include /product, /gene, /locus_tag, and /note.  Sequence – nucleotides listed in order and numbered. The start of this section is indicated with the label ORIGIN on the left.

43. Questions?

44. Question 1  1. How can you search Genebank for DNA sequences that are similar to your gene of interest?  a) Google  b) PubMed  c) MySpace  d) BLAST

45. Answer DBLAST

46. Question 2 If your E score is = 0 If your E score is = 0  a) The sequence is 100% match  b) The sequences are not alike  c) There is limited homology between sequences  d) Sequences are highly homologous

47. Answer A The e score shows the “expected” match value. The lower the score the more significant the alignment.

48. Question 3  What does PCR stand for?

49. Answer  Polymerase Chain Reaction

50. Exercise 1 You will:  Copy the sequence provided in the box on the Blast page of the NCBI :  websitehttp://www.ncbi.nlm.nih.gov/genome/se q/BlastGen/BlastGen.cgi?taxid=9606  Identify the name of the gene,  Provide the title of the publication where the sequence was first published, the name of the journal authors and the full title of the article.  What did you learn about this gene?

51. Exercise 1 continued  You will be provided with a list of sequences that you can use to perform BLAST searches.  For each sequence provided you will answer the questions from the previous slide.  If you need to review a BLAST tutorial you can find one at: http://www.digitalworldbiology.com/BLAST/slide1.html

52. Sequence 1 TCGAAATAACGCGTGTTCTCAACGCGGTCGCGCAGATGCCTTTGC TCATC AGATGCGACCGCAACCACGTCCGCCGCCTTGTTCGCCGTCCC CGTGCCTC AACCACCACCACGGTGTCGTCTTCCCCGAACGCGTCCCGGTC AGCCAGCC TCCACGCGCCGCGCGCGCGGAGTGCCCATTCGGGCCGCAGC TGCGACGGT GCCGCTCAGATTCTGTGTGGCAGGCGCGTGTTGGAGTCTAAA

53. Sequence 2  GTTTATTAGTGATCATGGCTAAGTTTGCGTCCATCATCGCACTT CTTTTT GCTGCTCTTGTTCTTTTTGCTGCTTTCGAAGCACCAACAATGGT GGAAGC ACAGAAGTTGTGCGAAAGGCCAAGTGGGACATGGTCAGGAGT CTGTGGAA ACAATAACGCATGCAAGAATCAGTGCATTAACCTTGAGAAAGC ACGACAT GGATCTTGCAACTATGTCTTCCCAGCTCACAAGTGTATCTGCTA CTTTCC TTGTTAATTTATCGCAAACTCTTTGGTGAATAGTTTTTATGTAAT TTACA CAAAATAAGTCAGTGTCACTATCCATGAGTGATTTTAAGACATG TACCAG ATATGTTATGTTGGTTCGGTTATACAAATAAAGTTTTATTCACCA

54. Sequence 3  CTCGAGACTAGTTCTCTCTCTCTCTCTCTCGTGCCGCATCTCAC ACCTGT GGATGGACGGCAGCTGAACCGCGGGAAACTTTCGTTCTCACTC TACCTAG ATGAACTTTAGTTTATATTAAACACGCGTCGACTCCCACACAAA CCGTGC TCGTTTTACATCTTTGTCTCCGCTTTTGAAAACGAGAAGTTGAA TTCGCA AGACGCAACTTTCCAGCCCCTCACTGAGCGGGCAGAGTCCGT GAAGCGAT GGAGCCGTCCGTCATTCCCGGTGCTGACATACCCGACCTTTAC TCCATTA ACCCGTTTAATGTCACTTTTCCCGACGACGTTTTGAGTTTCGTT CCTGAT GGGAGGAACTACACCGAACCTAACCCGGTAAAGAGCCGCG GAATCATCA TCGCCATTTCCATCACCGCTC

55. Reference Material  http://www.pseudomonas- syringae.org/Outreach/Module_4_Web.htm http://www.pseudomonas- syringae.org/Outreach/Module_4_Web.htm http://www.pseudomonas- syringae.org/Outreach/Module_4_Web.htm  http://www.digitalworldbiology.com/BLAST /slide1.html http://www.digitalworldbiology.com/BLAST /slide1.html http://www.digitalworldbiology.com/BLAST /slide1.html

56. Sequence DNA in Thermal Cycler Place tubes in thermal cycler Repeat the following for 25 cycles Rapid Thermal Ramp to 96˚C 96˚C for 10 secs Rapid Thermal ramp to50˚C 50˚C for 5 secs Rapid thermal ramp to 60˚C 60˚C for 4minutes Cool to 4˚C. Hold until ready to purify.