1. Fill in AP paper and then make a chart Enzyme Role In what process? Helicase DNA polymerase Topoisomerase Primase Ligase Nuclease Telomerase RNA polymerase snRNA

2. DNA Replication: A Closer Look The copying of DNA is remarkable in its speed and accuracy More than a dozen enzymes and other proteins participate in DNA replication Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

3. Origins of Replication Video

4. At the end of each replication bubble is a replication fork, a Y-shaped region where new DNA strands are elongating Helicases are enzymes that untwist the double helix at the replication forks Single-strand binding protein binds to and stabilizes single-stranded DNA until it can be used as a template Topoisomerase corrects “overwinding” ahead of replication forks by breaking, swiveling, and rejoining DNA strands Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

5. Fig. 16-13 Topoisomerase Helicase Primase Single-strand binding proteins RNA primer 5 5 53 3 3

7. DNA Polymerase 3’ 5’ 3’ 5’ Pol

8. Leading and Lagging Strands 5’ 3’ Leading Strand Lagging Strand Pol 3’ 5’ Okazaki Fragments RNA Primer Video

9. Other Proteins at Replication Fork Pol 5’ 3’ Leading Strand Lagging Strand Pol 3’ 5’ Okazaki Fragments Helicase Single Stranded Binding Proteins Primase DNA Pol I Ligase DNA Pol III

10. Fig. 16-16 Overview Origin of replication Leading strand Lagging strand Overall directions of replication Template strand RNA primer Okazaki fragment Overall direction of replication 1 2 3 2 1 1 1 1 2 2 5 1 3 3 3 3 3 3 3 3 3 5 5 5 5 5 5 5 5 5 5 5 3 3

11. Damaged DNA Nuclease Excision Repair Nuclease DNA Polymerase Ligase

12. Replicating the Ends of DNA Molecules Limitations of DNA polymerase create problems for the linear DNA of eukaryotic chromosomes The usual replication machinery provides no way to complete the 5 ends, so repeated rounds of replication produce shorter DNA molecules Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

13. Replicating Ends of Linear Chromosomes

14. Fig. 16-19 Ends of parental DNA strands Leading strand Lagging strand Last fragment Previous fragment Parental strand RNA primer Removal of primers and replacement with DNA where a 3 end is available Second round of replication New leading strand New lagging strand Further rounds of replication Shorter and shorter daughter molecules 5 3 3 3 3 3 5 5 5 5

15. If chromosomes of germ cells became shorter in every cell cycle, essential genes would eventually be missing from the gametes they produce An enzyme called telomerase catalyzes the lengthening of telomeres in germ cells Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

16. Telomerase

17. Central Dogma of Molecular Biology

21. Gene Structure PromoterTerminator Transcribed Region RNA ( ) Open Reading Frame 5’UTR 3’UTR

23. Three Parts to Transcription Transcriptional Initiation – – RNA polymerase binds to promoter – DNA strands separate – RNA synthesis begins as ribonucleotides complementary to template strand are linked Transcriptional Elongation – RNA polymerase moves down DNA unwinding a small window of DNA. – Nucleotides are added to the growing RNA chain Transcriptional Termination – When the RNA polymerase reaches terminator the RNA and the RNA polymerase are released from the DNA.

25. RNA Processing in Eukaryotes 5’ 3’ Modification of 5’ and 3’ ends Pre-mRNA (hnRNA) Spicing of exons 5’CAP Poly A tail Exon1 Intron1 Exon2 Intron2 Exon3 Intron3 Exon4

27. Genetic Code

28. Identifying ORF Locate start codon ( 1st ATG from 5’ end) Identify Codons (non overlapping units of three codons including and following start codon) Stop at stop codon ( remember stop codon doesn’t encode amino acid) Nucleotides before start codon – 5’UTR Nucleotides after stop codon - 3’UTR [MetArgAsnAlaSerLeu] GACGACGGAUGCGCAAUGCGUCUCUAUGAGACGUAGCUCAC 5’

29. Players in Translation mRNA – Genetic Code Ribosome – synthesizes protien tRNA – adaptor molecule Amino acids Aminoacyl tRNA synthetases - attach amino acids to tRNAs

30. Fig. 17-18-4 Amino end of polypeptide mRNA 5 3 E P site A site GTP GDP E P A E PA GTP Ribosome ready for next aminoacyl tRNA E P A

31. tRNA

33. Ribosomes

34. Three parts to Translation Initiation – Delivery of Ribosome with first tRNA to start codon. Elongation Cycle – Three Parts of Elongation Cycle Delivery of tRNA to A site Transpeptidase Activity – Amino acids on tRNA in P site cleaved from tRNA and attached to amino acid on tRNA in A site. Translocation – Ribosome ratchets over on codon. The tRNA that was in the A site is moved to the P site. The uncharged tRNA in the P site exits the ribosome through the E site. Termination – When ribosome reaches the stop codon a release factor binds to the A site and triggers the release of the polypeptide. The ribosome releases the tRNA and the mRNA.

35. The Functional and Evolutionary Importance of Introns Some genes can encode more than one kind of polypeptide, depending on which segments are treated as exons during RNA splicing Such variations are called alternative RNA splicing Because of alternative splicing, the number of different proteins an organism can produce is much greater than its number of genes Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

36. Fig. 17-12 Gene DNA Exon 1Exon 2 Exon 3 Intron Transcription RNA processing Translation Domain 2 Domain 3 Domain 1 Polypeptide

37. Polysomes

38. Polypeptide synthesis always begins in the cytosol Synthesis finishes in the cytosol unless the polypeptide signals the ribosome to attach to the ER Polypeptides destined for the ER or for secretion are marked by a signal peptide Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

39. A signal-recognition particle (SRP) binds to the signal peptide The SRP brings the signal peptide and its ribosome to the ER Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

40. Proteins targeted to ER

41. Functions of RNA mRNA – genetic code tRNA – adaptor molecules rRNA- part of ribosome snRNA – part of splicosome SRP RNA – part of SRP siRNA- eukaryotic gene regulation

42. Silent Mutations Missense Mutations Nonsense Mutations