1. 1. Chemical 2. Cellular 3. Tissue 4. Organ 5. Organ System 6. Organismic Human Body Organization Levels

2. Animal Cell Chromatin

3. DNA Base Pairs: A – T C – G Bases/Base Pairs Nucleotides 3. Nitrogenous Base 1. 2. (deoxyribonucleic acid)

4. DNA Organization Chromatin organized: DNA Histones One Duplicated Chromosome

5. Human Chromosomes A Pair of Duplicated Chromosomes Autosomes 46 individual chromosomes / 23 pairs of chromosomes they are the same - code for same type of trait they are different - code for different version of trait Sex Chromosomes

6. Understanding the Numbers 1 chromosome is 1 large DNA molecule a gene is a specific sequence of nucleotides ATTCCGTAGCTGATCGTAAAGGG 1000-2000 genes per chromosome ~25,000 - 30,000 genes per human genome

7. DNA Functions Pass on Genetic Material Replication Mitosis Meiosis Protein Synthesis Transcription Translation

8. Mitosis

9. Replication Making an exact copy of DNA Occurs just prior to cell division Double helix unwinds DNA polymerase adds bases Two exact copies are made

10. Blastocyst Inner Cell Mass (Embryonic Stem Cells) Pluripotent Stem Cells Embryongenesis - Week 1

11. Embryogenesis Week 2 Embryonic Germ Cell Layers: Endoderm Mesoderm Ectoderm Multipotent Stem Cells

12. Growth Cone Cell Migration

13. Act like scaffolding to assist movement of neurons during development Radial Glia

14. Differentiation

15. Schizophrenia Abnormality Hippocampal Pyramidal Cell Disorganization

16. Neurobehavioral Hypothesis Maternal/Fetal Evidence: extensive maternal bleeding prolonged labor delivery complications low birth weight low head circumference body length:body weight multiparity Anectodal Evidence Dutch births during WWII Season of birth effect higher for winter pregnancies parallel with virus exposure

17. Protein Synthesis Transcription DNA to mRNA Translation mRNA to Protein

18. From Gene to Protein DNA RNA Protein

19. Genetic Code Codons three base code Code for specific amino acids

20. Point Mutation Spontaneous Mutation Environmental Insult Mutagenesis Carcinogenesis Mutation is corrected

21. Point Mutation Mutation is not corrected Mutation is corrected

22. Sickle-Cell Anemia Mutation

24. Two-Hit Hypothesis Born with 2 genes or alleles for any given disease: one from mom one from dad If one is bad, this increases your chance of getting the disease

25. Cancer in Women

26. Lung Cancer