1. The Application of Single Nucleotide Polymorphisms (SNPs) and Lung Cancer Risk Zuo-Feng Zhang, MD, PhD

2. Epidemiology of Lung Cancer Worldwide statistics (2002) – Incidence: ranked #1 (1.35 million cases) – Mortality: ranked #1 (1.18 million deaths) – 5-year survival rate: around 10% in Europe; 8.9% in developing countries U.S. statistics (2006) – Incidence: ranked #3 (174,470 cases) – Mortality: ranked #1 (162, 460 deaths) – 5-year survival rate: 15%

3. Risk Factors for Lung Cancer – Tobacco smoking – ETS – Asbestos – Radon exposure – Occupational exposures – Air pollution – Other radiation – Recurring inflammation – Family history of cancer – Insufficient diet and poor nutritional factors

4. If DNA damage not repaired DNA damage repaired If loose cell cycle control Defected DNA repair gene G1 S G2 M P53 Cyclin D1 P16 Environmental Carcinogens / Procarcinogens Exposures Nitrosemins, Xenobiotics, Diet/nutrient Active carcinogens Detoxified carcinogens DNA Damage Normal cell Carcinogenesis Programmed cell death Tobacco/alcohol infection Diet and nutritional factors CYP2E1 GSTP1 mEH NQO1 XRCC3 GSTM1 Theoretical model of gene-environmental interaction pathway for lung cancer susceptibility Ile 105 Val  Ala 114 Val  Tyr 113 His  His 139 Arg  Tyr 113 His  His 139 Arg  Pro 187 Ser  Null  Ala 146 Thr Arg 72 Pro  G 870 A  G0 Diet/nutrient Free radicals Oxidative Stress

5. DNA Repair Pathways Direct Reversal (DR) Mismatch Repair (MMR) Base Excision Repair (BER) Nucleotide Excision Repair (NER) Double Strand Break Repair (DSBR)

14. BER Pathway

15. Polymorphisms in the BER pathway may alter the repairing capacity of this pathway and modify the risk of lung and head-and-neck cancers. To examine the individual associations of the – hOGG1 Ser326Cys, – APEX1 Asp148Glu, – PCNA C  T (intron 2), – XRCC1 Arg194His and Arg280His, – LIG1 T  C (exon 25), A  C (exon 6), C  T (exon 2), and A  G (intron 1), – and LIG3 C  T (exon 21) polymorphisms – with the risk of lung and head-and-neck cancer, and to investigate whether these polymorphisms alter the effects of environmental risk factors, including active and passive cigarette smoking and alcohol drinking, on the development of lung and head-and-neck cancer in the population of Los Angeles County.

16. Study Design Study design: A population-based case-control study in Los Angeles County Subjects Selection Criteria – Patients must be newly diagnosed – Both genders – Ages 18-65 years – Residents of Los Angeles County during the observation period (1999-2004) – In stable medical condition as determined by their physician Epidemiology data collection – Interviewed by trained interviewers; 30 ml of buccal cell samples were collected during the time of interviews

17. Data sources Data from cancer surveillance program Questionnaire data Buccal cells were collected – About 90% of subjects donated buccal cells. Dietsys USDA food composition data Continuing survey of food intake for individuals (CSFII) sociodemographic characteristics history of tobacco smoking environmental tobacco smoking drug use alcohol use occupational exposures environmental exposures selected clinical factors food frequency questionnaire

18. RESPONSE RATES OF THE PARTICIPANTS EligibleInterviewed (%)Buccal Biospecimen (%) Control15401040 (67.5)928 (89.2) Lung1577611 (38.7)544 (89.0) Oral584303 (51.9)195 (64.4) Esophageal316108 (34.2)97 (89.8) Pharynx238100 (42.0)77 (77.0) Larynx22690 (39.8)79 (87.8)

19. Laboratory Assays DNA Extraction and Genotyping – Genomic DNA was isolated using a modified phenol- chloroform protocol. – Genotyping of the SNPs was assayed by SNPlex TM techniques. – PCR-RFLP was used for validation

21. Confounding Variables Age – <35, 35-36, 37-38, 39-40, 41-42, 43-44, 45-46, 47-48, 49-50, 51-52, 53-54, 55-56, 57-58, and 59-62 Gender Race/ethnicity – white, Mexican American, African American, Asian American, and other Education level – years of schooling Pack-years of smoking Alcohol consumption (for head-and-neck cancer only) – alcohol drink-years

22. Logistic Regression Model for Individual Associations Logit (R)= α + β1(PCNA) + β2(pack- years) + β3(age) + β4 (gender) + β5(education level) + β6(ethnicity)

23. Interaction Assessment To assess a potential gene-environment interaction, a product term is added that allows the effect estimate for one variable to vary within levels of another, and vice versa. Logit (R)= α + β1(PCNA) + β2(smokingY/N) + β3(age) + β4 (gender) + β5(education level) + β6(ethnicity) +  12 (PCNA  smokingY/N)

24. False Positive Assessment FPRP =  (1-  )/[  (1-  )+(1-  )  ] = 1/{1+[  /(1-  )][(1-  )/  ]}  : prior probability  : statistical size 1-  : probability of rejecting when alternative hypothesis is true Wacholder et al., 2004

25. Haplotype Method SNPs in one gene may have linkage disequilibrium and may be associated with cancer risk as haplotype or linked with unmeasured candidate genes. Haplotypes were reconstructed using the PHASE version 2.

26. Statistical Analysis We used SAS 9.1 software to perform data analyses. Primarily, unconditional logistic regression was employed to obtain odds ratios and 95% confidence limits. Stratified analysis was used to assess effect modification.

27. Demographic characteristics for lung cancer cases and population controls VariablesLung Cancer Cases (n = 611) N (%) Controls (n = 1029) N (%) With DNA (551) Without DNA (60) With DNA (939) Without DNA (90) Mean Age (years) (Age range) 52.2 (32 – 59) 52.3 (41 – 59) 50.2 (29 – 62) 49.5 (30 – 60) P-value = 0.90P-value = 0.37 Age (years) < 35 35-44 45-54  55 4 (0.73) 51 (9.3) 273 (50) 223 (40) 0 (0.0) 6 (10) 28 (47) 26 (43) 38 (4.1) 155 (17) 452 (48) 294 (31) 3 (3.3) 16 (18) 47 (52) 24 (27) P-value = 0.88P-value = 0.79 Race/Ethnicity Caucasian Mexican American African American Asian American Other Missing 320 (58) 50 (9.1) 90 (16) 59 (11) 31 (5.6) 1 39 (65) 3 (5.0) 6 (10) 11 (18) 1 (1.7) 0 583 (62) 140 (15) 79 (8.4) 53 (5.7) 83 (8.9) 1 45 (50) 8 (8.9) 23 (25) 7 (7.8) 0 P-value = 0.13P-value < 0.0001 Gender Male Female 278 (50) 273 (50) 25 (42) 35 (58) 575 (61) 364 (39) 41 (46) 49 (54) P-value = 0.20P-value = 0.004 Education Level  12 years >12 -  16 years > 16 years Missing 248 (45) 55 (10) 0 17 (28) 27 (45) 16 (27) 0 276 (29) 422 (45) 240 (26) 1 23 (26) 49 (54) 18 (20) 0 P-value = 0.0003P-value = 0.22

28. Association between tobacco smoking and alcohol consumption and lung cancer risk Tobacco Smoking CasesControlsAdjusted OR (95% CL) Pack-Years* 01104841.0 >0-201023501.4 (0.99, 1.9) >20-402021368.3 (6.0, 12) >401975822 (15, 33) TrendsP trend <.0001 Alcohol(drinks/day)** 0 - <24468701.0  2 1641561.1 (0.80, 1.5) *Adjusted for age, gender, ethnicity, and education. **Adjusted for age, gender, ethnicity, education and pack-years of smoking.

29. THE ASSOCIATION BETWEEN PCNA (C  T) (rs25406) IN INTRON 2 AND LUNG CANCER RISK Stratified byCases N (%) Controls N (%) Crude OR (95% CL) Adjusted OR (95% CL) PCNA genotypes a CC128 (33.3)259 (36.3)1.0 CT177 (46.1)357 (50.1)1.0 (0.76, 1.3)0.90 (0.65, 1.2) TT79 (20.6)97 (13.6)1.6 (1.1, 2.4)1.4 (0.89, 2.1) P trend = 0.0228P trend = 0.3060 CC + CT305 (79.4)616 (86.4)1.0 TT79 (20.6)97 (13.6)1.6 (1.2, 2.3)1.5 (0.99, 2.1) Pack-years of Smoking b 0 CC + CT55 (85.9)289 (86.8)1.0 TT9 (14.1)44 (13.2)1.1 (0.50, 2.3)0.89 (0.38, 2.0) >0 – 20 CC + CT49 (84.5)211 (85.4)1.0 TT9 (15.5)36 (14.6)1.1 (0.49, 2.4)0.97 (0.43, 2.2) >20 CC + CT201 (76.7)116 (87.2)1.0 TT61 (23.3)17 (12.8)2.1 (1.2, 3.7)2.4 (1.3, 4.5) a Adjusted for gender, age, education, ethnicity, and tobacco smoking (pack-years). b Adjusted for gender, age, education, and ethnicity.

30. THE ASSOCIATION BETWEEN PCNA (C  T) (rs25406) IN INTRON 2 AND LUNG CANCER RISK Stratified byCases N (%) Controls N (%) Crude OR (95% CL) Adjusted OR (95% CL) Alcohol Drinking (Drinks/Day) a 0 - <2 CC + CT227 (82.2)517 (86.6)1.0 TT49 (17.8)80 (13.4)1.4 (0.95, 2.1)1.3 (0.80, 2.0)  2 CC + CT77 (72.0)98 (85.2)1.0 TT30 (28.0)17 (14.8)2.2 (1.2, 4.4)2.2 (0.99, 4.9) a Adjusted for gender, age, education, ethnicity, and tobacco smoking (pack-years).

32. THE ASSOCIATION BETWEEN PCNA (C  T) (rs25406) IN INTRON 2 AND LUNG CANCER RISK Stratified byCases N (%) Controls N (%) Crude OR (95% CL) Adjusted OR (95% CL) Histology a Large cell CC + CT50 (73.5)616 (86.4)1.0 TT18 (26.5)97 (13.6)2.3 (1.3, 4.1)2.1 (1.1, 4.1) Small cell CC + CT38 (80.8)616 (86.4)1.0 TT9 (19.2)97 (13.6)1.5 (0.71, 3.2)1.6 (0.67, 3.9) Squamous cell CC + CT45 (83.3)616 (86.4)1.0 TT9 (16.7)97 (13.6)1.3 (0.60, 2.7)1.2 (0.51, 2.9) Adenocarcinoma CC + CT156 (78.8)616 (86.4)1.0 TT42 (21.2)97 (13.6)1.7 (1.1, 2.6) a Adjusted for gender, age, education, ethnicity, and tobacco smoking (pack-years).

33. THE ASSOCIATION BETWEEN PCNA (C  T) (rs25406) IN INTRON 2 AND LUNG CANCER RISK Stratified byCases N (%) Controls N (%) Crude OR (95% CL) Adjusted OR (95% CL) Ethnicity c Caucasian CC + CT174 (76.0)386 (86.3)1.0 TT55 (24.0)61 (13.7)2.0 (1.3, 3.0)1.9 (1.1, 3.2) Mexican/Hispanic CC + CT27 (93.1)101 (91.8)1.0 TT2 (6.9)9 (8.2)0.83 (0.17, 4.1)0.64 (0.11, 3.9) African American CC + CT50 (84.7)48 (81.4)1.0 TT9 (15.3)11 (18.6)0.79 (0.30, 2.1)0.66 (0.20, 2.2) Asian CC + CT38 (86.4)28 (80.0)1.0 TT6 (13.6)7 (20.0)0.63 (0.19, 2.1)0.48 (0.12, 1.8) Other** CC + CT16 (72.7)53 (85.5)1.0 TT6 (27.3)9 (14.5)2.2 (0.68, 7.1)2.7 (0.72, 10) c Adjusted for age, gender, education, and tobacco smoking (pack-years).

34. Gene SNP StratumOR (95%CL) Power under recessive model a Reported P value Prior Probability b.5.25.1.01.001 PCNAAll (TT vs. CC+CT) 1.5 (0.99, 2.1)0.790.018.022.065.172.695.958 Heavy smokers2.4 (1.3, 4.5)0.250.006.025.071.186.715.962 Heavy drinkers2.2 (0.99, 4.9)0.210.054.203.434.697.962.996 Large cell2.1 (1.1, 4.1)0.260.030.103.255.507.919.991 Adenocarcinoma1.7 (1.1, 2.6)0.490.014.028.081.209.744.967 Caucasian1.9 (1.1, 3.2)0.460.016.033.093.236.773.972 FALSE POSITIVE REPORT PROBABILITY FOR MAJOR LUNG CANCER RESULTS a Estimation of the statistical power to detect an OR of 1.5 with  level of 0.05. b False-positive report probabilities for the observed odds ratios.

35. ASSOCIATIONS OF THE LIG1 HAPLOTYPES OF THE FOUR SNPS AND LUNG CANCER TCCACACACATACCCGCCCACCTATACAAll Others Overall, n (case/control) 346/695325/582112/16951/6511/2518/283/810/6 Crude OR 1.01.1 (0.93, 1.4) 1.3 (1.0, 1.4) 1.6 (1.1, 2.3) 0.88 (0.43, 1.8) 1.3 (0.70, 2.4) 0.75 (0.20, 2.9) 3.3 (1.2, 9.3) Adj OR a 1.01.2 (0.95, 1.5) 1.4 (1.0, 1.9) 1.8 (1.1, 2.8) 0.81 (0.35, 1.9) 1.6 (0.78, 3.1) 1.3 (0.31, 5.9) 3.2 (0.99, 11) * Adjusted for gender, age, education, ethnicity, and tobacco smoking (pack-years).

36. ASSOCIATIONS OF THE LIG1 HAPLOTYPES AND LUNG CANCER TCCACACACATACCCGCCCACCTATACAAll Others Stratified by Smoking status Never 55/32268/27215/7113/301/15 0/51/2 Crude OR 1.0 1.5 (1.0, 2.2) 1.2 (0.66, 2.3) 2.5 (1.2, 5.2) 0.39 (0.051, 3.0) 0.39 (0.051, 3.0) -2.9 (0.26, 33) Adj Or b 1.0 1.4 (0.94, 2.1) 1.2 (0.62, 2.2) 2.3 (1.1, 4.8) 0.34 (0.043, 2.6) 0.40 (0.051, 3.1) -2.6 (0.22, 30) Former 209/252180/20863/6327/187/912/82/28/4 Crude OR 1.0 (0.80, 1.4) 1.2 (0.81, 1.8) 1.8 (0.97, 3.4) 0.94 (0.34, 2.6) 1.8 (0.73, 4.5) 1.2 (0.17, 8.6) 2.4 (0.72, 8.1) Adj OR b 1.0 (0.79, 1.4) 1.2 (0.78, 1.8) 1.5 (0.78, 2.8) 0.84 (0.30, 2.3) 2.1 (0.84, 5.3) 1.3 (0.18, 9.1) 2.9 (0.84, 9.8) Current 82/12177/10234/3511/173/15/51/11/0 Crude OR 1.0 1.1 (0.74, 1.7) 1.4 (0.83, 2.5) 0.96 (0.43, 2.1) 4.4 (0.45, 43) 1.5 (0.41, 5.3) 1.5 (0.091, 24) - Adj OR b 1.0 1.1 (0.74, 1.7) 1.5 (0.85, 2.6) 0.94 (0.41, 2.2) 4.4 (0.44, 44) 1.3 (0.35, 4.6) 1.5 (0.088, 26) - b Adjusted for gender age, education, and ethnicity.

37. MULTIGENETIC ASSOCIATION WITH LUNG CANCER # of Potential Risk Genotypes CasesControlCrude ORAdjusted OR* 050 (24.5)157 (34.3)1.0 1-2122 (59.8)237 (51.7)1.6 (1.1, 2.4)1.7 (1.1, 2.7) 3-532 (15.7)64 (14.0)1.6 (0.92, 2.7)2.2 (1.1, 4.1) P trend = 0.038P trend = 0.0104 Continuous1.1 (0.98, 1.3)1.2 (1.0, 1.5) * Adjusted for age, gender, education, race/ethnicity and pack-years of smoking.

38. Discussion on BER Results We observed an overall association of PCNA (C  T) SNP with lung cancer risk, and the smoking status in pack-years and alcohol drinking status seemed to modify the association of PCNA SNP with lung cancer. We did not detect any consistent association between individual LIG1 polymorphisms and lung cancer. When we considered all the SNPs together as haplotypes, we observed the associations between the LIG1 haplotypes and the cancer risks. The dose-response association of these SNPs in the BER pathway suggested the possible interaction among these SNPs since they are the components involved in this pathway. This also explained why we could not detect the individual SNP association. The SNPs in the same pathway work together to maintain the genome stability.

39. NER Pathway Costa RM, 2003

40. XPG polymorphism and the risk of lung cancer 1 Adjusted for age, sex, race-ethnicity, educational level, and tobacco smoking.

41. Joint effect of tobacco smoking and XPG polymorphism on lung cancer risk Pack-years: Never 1-20 >20 Never 1-20 >20 XPG: Asp/Asp Asp/Asp Asp/Asp His/His +His/Asp His/His +His/Asp His/His +His/Asp Departure from additivity: 23-13-1.9+1=9.1, 95% CL=-2.9, 21.7

42. Joint effect of tobacco, alcohol, and XPG polymorphism on SCCUAT Drinks per day: 1-2 1-2 >=3 >=3 1-2 1-2 >=3 >=3 Packyears: 20 >20 >20 >20 XPG: Asp/Asp His/His +His/Asp Asp/Asp His/His +His/Asp Asp/Asp His/His +His/Asp Asp/Asp His/His +His/Asp

43. NERCases (%)Controls (%)Crude ORAdjusted OR* All Lung Cancer Cases ERCC6 Q1413R Q/Q251 (62.0%)451 (61.4)1.0 Q/R125 (30.9%)254 (34.6%)0.88 (0.68, 1.15)1.23 (0.89, 1.70) R/R29 (7.2%)29 (4.0%)1.80 (1.05, 3.08)2.10 (1.09, 4.03) Ptrend=0.02 Q/Q + Q/R376 (92.8%)705 (96.1%)1.0 R/R29 (7.2%)29 (4.0%)1.88 (1.10, 3.19)1.94 (1.02, 3.68) Total405 (100%)734 (100%) ERCC6 R1230P R/R420 (85.4%)756 (86.7%)1.0 P/R67 (13.6%)107 (12.3%)1.13 (0.81, 1.56)1.13 (0.76, 1.69) P/P5 (1.0%)9 (1.0%)1.00 (0.33, 3.00)1.37 (0.36, 5.26) Ptrend=0.46 P/R + P/P72 (14.6%)116 (13.3%)1.0 R/R420 (85.4%)756 (86.7%)0.90 (0.65, 1.23)0.87 (0.59, 1.29) Total492 (100%)872 (100%)

44. * adjusted for age, gender, ethnicity, educational level and pack-years of tobacco smoking TABLE III – ASSOCIATION BETWEEN THE NER POLYMORPHISM AND THE RISK OF LUNG CANCER STRATIFIED BY PATHOLOGICAL DIAGNOSIS Gene / SNPCases (%)Controls (%)Crude ORAdjusted OR* RCC6 Q1413R Adenocarcinoma Q/Q + Q/R184 (92.5%)705 (96.1%)1.0 R/R15 (7.5%)29 (4.0%)1.98 (1.04, 3.77)2.19 (1.05, 4.59) Total199 (100%)734 (100%) Squamous Q/Q + Q/R59 (95.2%)705 (96.1%)1.0 R/R3 (4.8%)29 (4.0%)1.24 (0.37, 4.18)1.66 (0.38, 7.19) Total62 (100%)734 (100%) Small Cell Q/Q + Q/R46 (90.2)705 (96.1%)1.0 R/R5 (9.8%)29 (4.0%)2.64 (0.98, 7.15)2.18 (0.63, 7.47) Total51 (100%)734 (100%) Large Cell Q/Q + Q/R72 (93.5%)705 (96.1%)1.0 R/R5 (6.5%)29 (4.0%)1.69 (0.63, 4.50)2.19 (0.71, 6.78) Total77 (100%)734 (100%)

45. Smoker ERCC6 Q1413RCasesControlsAdjusted OR* NoQ/Q + Q/R643241.0 NoR/R2180.59 (0.12, 2.82) YesQ/Q + Q/R3123814.41 (3.18, 6.14) YesR/R271119.44 (8.33, 45.35) OR interaction =5.82 (1.08, 31.38) SmokerERCC6 R1230PCasesControlsAdjusted OR* NoR/R412021.0 NoP/R + P/P251402.87 (1.28, 6.40) YesR/R2102494.29 (3.12, 5.92) YesP/R + P/P1291435.63 (3.43, 9.24) OR interaction =0.56 (0.25, 1.27)

46. * adjusted for age, gender, ethnicity, educational level and pack-years of tobacco smoking TABLE III – ASSOCIATION BETWEEN THE NER POLYMORPHISM AND THE RISK OF LUNG CANCER STRATIFIED BY PATHOLOGICAL DIAGNOSIS Gene / SNPCases (%)Controls (%)Crude ORAdjusted OR* RCC6 Q1413R Adenocarcinoma Q/Q + Q/R184 (92.5%)705 (96.1%)1.0 R/R15 (7.5%)29 (4.0%)1.98 (1.04, 3.77)2.19 (1.05, 4.59) Total199 (100%)734 (100%) Squamous Q/Q + Q/R59 (95.2%)705 (96.1%)1.0 R/R3 (4.8%)29 (4.0%)1.24 (0.37, 4.18)1.66 (0.38, 7.19) Total62 (100%)734 (100%) Small Cell Q/Q + Q/R46 (90.2)705 (96.1%)1.0 R/R5 (9.8%)29 (4.0%)2.64 (0.98, 7.15)2.18 (0.63, 7.47) Total51 (100%)734 (100%) Large Cell Q/Q + Q/R72 (93.5%)705 (96.1%)1.0 R/R5 (6.5%)29 (4.0%)1.69 (0.63, 4.50)2.19 (0.71, 6.78) Total77 (100%)734 (100%)

47. Double Strand Break Repair

48. NBS1 protein (Nibrin or p95) Has 3 known functional regions: N-terminus (1-196 a.a.) Central region (278-343 a.a.) C-terminus (665-693 a.a.) – Believed to bind site to the MRN complex

49. VariableControls (%) HWE p- value Cases (%)HWE p- value Crude OR (95% CI) OR adj (95% CI)* Ex16+1785 T>C T/T369 (45.95)211 (46.68)1.0 C/T363 (45.21)0.19188 (41.59)0.280.91 (0.71, 1.16)0.85 (0.63, 1.13) C/C71 (8.84)53 (11.73)1.31 (0.88, 1.94)1.12 (0.69, 1.80) Missing226159p-trend= 0.5974 Ex16+572 C>G C/C397 (45.74)223 (45.70)1.0 C/G397 (45.74)0.83208 (42.62)0.410.93 (0.74, 1.18)0.88 (0.67, 1.17) G/G74 (8.53)57 (11.68)1.37 (0.94, 2.01)1.35 (0.85, 2.14) Missing161123p-trend=0.628 Pro672Pro A/A356 (44.33)233 (50.76)1.0 A/G366 (45.58)0.40169 (36.82)0.0043 a 0.71 (0.55, 0.90)0.71 (0.53, 0.95) G/G81 (10.09)57 (12.42)1.08 (0.74, 1.57)1.25 (0.80, 1.96) Missing226152p-trend=0.7126

50. Table III. Association of Pro672Pro and lung cancer (smoking and passive smoking exposure) Pro672ProControls (%)Cases (%)Crude OR (95% CI)OR adj (95% CI)* Never-smokers wt/wt170 (45.3)32 (39.5)1.0 wt/var165 (44)34 (42.0)1.10 (0.65, 1.86)1.27 (0.71, 2.26) var/var40 (10.7)15 (18.5)1.99 (0.99, 4.03)1.92 (0.85, 4.36) Ever-smokers wt/wt186 (43.5)201 (53.2)1.0 wt/var201 (47.0)135 (35.7)0.62 (0.46, 0.84)0.66 (0.48, 0.90) var/var41 (9.6)42 (11.1)0.95 (0.59, 1.52)1.22 (0.73, 2.05) Passive no exposure wt/wt40 (46.5)10 (40.0)1.0 wt/var39 (45.4)10 (40.0)1.03 (0.38, 2.74)1.57 (0.47, 5.23) var/var7 (8.1)5 (20.0)2.86 (0.75, 10.92)5.42 (0.88, 33.54) Yes exposure wt/wt130 (45.1)22 (39.3)1.0 wt/var126 (43.8)24 (42.9)1.13 (0.60, 2.11)1.29 (0.65, 2.55) var/var32 (11.1)10 (17.9)1.85 (0.80, 4.28)1.59 (0.61, 4.13)

51. Table IV. Associations of NBS1 polymorphisms and lung cancer, stratified by smoking and passive smoking VariablesEx16+1785 T>CEx16+572 C>G ControlsCasesOR adj (95% CI)*controlsCasesOR adj (95% CI)* Stratify by smoking No wt/wt + wt/var345681.0376751.0 var/var28102.05 (0.86, 4.87)34131.82 (0.83, 3.99) Yes wt/wt + wt/var3873311.04183561.0 var/var43 1.19 (0.74, 1.92)40441.35 (0.84, 2.19) Stratified by passive smoking No wt/wt + wt/var80241.090281.0 var/var610.61 (0.04, 9.31)710.40 (0.03, 5.38) Yes wt/wt + wt/var265441.0286471.0 var/var2192.84 (1.11, 7.28)26122.74 (1.16, 6.47)

52. DNA Methylation and Risk of Lung Cancer

53. Source: Sharp 2004. THF cycle Methionine cycle

54. DNA Methylation and Lung Cancer Risk

55. P16 hypermethylation and Lung Cancer Risk by smoking, drinking, and folate intake

56. MGMT hypermethylation and Lung cancer Risk by smoking, drinking, and folate intake

57. GSTP1 hypermethylation and Lung cancer Risk by smoking, drinking, and folate intake

58. Number of methylated genes and lung cancer Risk by smoking, drinking, and folate intake

59. Folate intake, MTHFR C677T Polymorphism on Lung Cancer Risk ControlSCLCNSCLC N (%) Adjusted OR (95% CI) N (%)Adjusted OR (95% CI) Folate intake (μg/day) 11 >300102 (12)4 (6)1.0056 (12)1.00 200-300265 (31)17 (25)1.59 (0.47-5.44)136 (29)1.15 (0.72-1.83) 100-200412 (48)34 (51)1.52 (0.45-5.10)214 (46)0.83 (0.52-1.33) ≤10078 (9)12 (18)2.14 (0.52-8.85)63 (13)0.80 (0.43-1.50) P for trend0.38970.1640 MTHFR C677T22 CC391 (42)32 (49)1.00211 (49)1.00 CT411 (45)26 (40)0.89 (0.48-1.65)171 (40)0.78 (0.59-1.04) TT118 (13)7 (11)1.11 (0.44-2.82)49 (11)0.86 (0.56-1.34) 1.Adjusted for age, sex, race, pack-years of smoking, total energy intake and BMI 2.Adjusted for age, sex, race, and pack-years of smoking

60. Folate on Lung Cancer Risk by Smoking and Drinking ControlSCLCNSCLC NNAdjusted OR (95% CI) NAdjusted OR (95% CI) SmokingFolate intake (μg/day) 11 Never>20018321.00381.00 ≤20021910.67 (0.05-5.81)511.07 (0.66-1.74) Former>200120151.001111.00 ≤200185291.29 (0.62-2.65)1650.92 (0.64-1.33) Current>2006441.00431.00 ≤20086163.05 (0.88-10.60)611.05 (0.61-1.81) Drinking22 Light>200303171.001231.00 ≤200428320.82 (0.39-1.72)2160.76 (0.55-1.06) Heavy>2006341.00691.00 ≤20061144.08 (0.85-19.66)610.70 (0.37-1.31) 1.Adjusted for age, sex, race, total energy intake, and BMI 2.Adjusted for age, sex, race, pack-years of smoking, total energy intake, and BMI

61. MTHFR C677T Polymorphism on Lung Cancer Risk by Drinking ControlSCLCNSCLC DrinkingMTHFR C677T NNAdjusted OR (95% CI) NAdjusted OR (95% CI) LightCC326251.001531.00 CT/TT450260.95 (0.50-1.81)1520.73 (0.54-0.98) HeavyCC6571.00571.00 CT/TT7670.87 (0.23-3.31)581.20 (0.67-2.16) Adjusted for age, sex, race, and pack-years of smoking

62. Folate and MTHFR C677T Polymorphism on Lung and Head and Neck Cancer Risks among Heavy Drinkers Contro l SCLCNSCLCSCCHN Heavy Drinker NNAdjusted OR (95% CI) NAdjusted OR (95% CI) NAdjusted OR (95% CI) >200CC270281.00271.00 >200CT/TT3121.00331.12 (0.46-2.71)290.78 (0.34-1.79) ≤200CC287250.63 (0.24-1.66)281.31 (0.52-3.28) ≤200CT/TT2642.67 (0.20- 35.60) 321.02 (0.40-2.65)322.17 (0.86-5.45) Adjusted for age, sex, race, pack-years of smoking, total energy intake, and BMI

63. IL-10 and IFNGR1 Polymorphisms and Lung Cancer

64. Measures of association COPD – Prospective study: HR = 1.29, (1.09-1.53). Littman 2004. – Hospital-based CC study, OR = 2.3 (1.2 – 4.3), adj for age, sex, smoking. Nakayama 2003 Tuberculosis – LC tends to develop in Tb-scarred regions – 2.1 (1.4-3.1) Infection – HPV: OR = 3.5 (1.5-8.0), HPV-16/18: 8.0 (1.4-44.9). Nadji 2006. – H. pylori: some suggestive studies, but lacking in sample size

65. Modulation of Immune Response Achieved through balance of T-helper (T h ) cells via cytokine expression – Type 1: pro-inflammatory, cellular immune response Secrete IFNG – Type 2: anti-inflammatory, humoral immune response Secrete IL-10 Activation of one T h -cell pathway inactivates the other

66. Inflammatory Anti-inflammatory

67. SNPs IL-10 – -7334 T→C, AKA IL-10-819 – -6653 A→C, AKA IL-10-592 – TA haplotype associated with low IL-10 production IFNGR1 – Associated with altered immune cell function (mice) and respiratory disease (humans) – Ex7 +189 T→G

68. Table 1

69. Table 2

70. Table 3

71. Table 3, cont

72. Table 4 OR int = 23.44 – 12.10 – 3.83 + 1 = 8.51 Additive Interaction

73. Acknowledgments Dr. Amy Lee Dr. Yan Cui Ms. Shu-Chun Chuang Ms. Lani Park Mr. Yiren Wang Mr. Sam Oh Dr. Barbara Visscher Dr. Eric Hurwitz Dr. Donald P. Tashkin Dr. Jian Yu Rao Dr. Jenny Papp Dr. Hal Morgenstern, Dr. Sander Greenland Dr. Wei Cao Dr. Wendy Cozen Dr. Thomas M. Mack