Presentation is loading. Please wait.

Presentation is loading. Please wait.

DNA RNA Cell Membrane - Protection, transporters, sensors Nucleus - Information (the genes) THE CELL.

Similar presentations


Presentation on theme: "DNA RNA Cell Membrane - Protection, transporters, sensors Nucleus - Information (the genes) THE CELL."— Presentation transcript:

1

2

3

4

5

6 DNA RNA Cell Membrane - Protection, transporters, sensors Nucleus - Information (the genes) THE CELL

7 DNA RNA Cell Membrane - Protection, transporters, sensors Nucleus - Information (the genes) Ribosomes, membrane network – Manufacturing center for proteins and membranes THE CELL

8 DNA RNA Cell Membrane - Protection, transporters, sensors Nucleus - Information (the genes) Ribosomes, membrane network – Manufacturing center for proteins and membranes Mitochondria – Energy production in the form of ATP THE CELL ATP

9 DNA RNA Cell Membrane - Protection, transporters, sensors Nucleus - Information (the genes) Ribosomes, membrane network – Manufacturing center for proteins and membranes Mitochondria – Energy production in the form of ATP Lysosomes - Recycling and storage of molecules THE CELL ATP

10 The Central Dogma of Molecular Biology DNA RNA Protein

11 DNA Structure

12

13

14 The Genetic Code Three letters make a “word” (specify an amino acid) ATG means start, with the amino acid methionine TAA or TAG or TGA means stop MetArgCysAlaGlnCysHisThrLeuGluGluGlyGlyGlyAsn ATGCGTTGCGCTCAGTGCCACACCCTTGAGGAGGGCGGCGGCAACTAA AUGCGUUGCGCUCAGUGCCACACCCUUGAGGAGGGCGGCGGCCAACUAA DNA RNA PROTEIN

15

16 Lysozyme

17

18 http://vimeo.com/6812276

19 Our Course Bill Saxton Al Zahler Karen Otteman Molecular motors, Biology of cancer cells Helicobacter and transport in cells gene splicing human disease


Download ppt "DNA RNA Cell Membrane - Protection, transporters, sensors Nucleus - Information (the genes) THE CELL."

Similar presentations


Ads by Google