2. ©2001 Timothy G. Standish Isaiah 33:22 22For the Lord is our judge, the Lord is our lawgiver, the Lord is our king; he will save us.

3. ©2001 Timothy G. Standish Molecular Basis Of Inheritance Timothy G. Standish, Ph. D.

4. ©2001 Timothy G. Standish Correlation and Interpretation The United States has never lost a war in which the military used mules Illogical conclusion - If the US is in a war that it wants to win, it had better use mules Correlation between two variables, in this case victory and mules, does not mean that a cause-and-effect relationship is at play The United States has fought wars and won with no mules, i.e., the Persian Gulf war, thus mules are not the magic ingredient for victory How data are viewed, the questions that are asked and conclusions drawn are frequently the product of researcher’s values and beliefs

5. ©2001 Timothy G. Standish On Value Free Science The idea that science should (or can) be value-free is wrong... being steeped in values is part of being human. The success of science comes not from researcher’s attempts to be objective, but from its adherence to rules (honesty, disclosure of procedures, attempts to disprove hypotheses) and its adversarial nature... Scientists’ credibility should rest on openness about uncertainties... Scientist should not dictate what society wants, but rather interact vigorously with other scholars and the public to achieve ends that both are feasible and make sense scientifically. Ehrlich, Paul R. 2000. Evolution of an Advocate. Science 287:2159

6. ©2001 Timothy G. Standish The Scientific Method The Scientific method relies on two types of reasoning: Inductive reasoning - Drawing generalized conclusions from data. This type of reasoning is used when coming up with a theory Deductive reasoning - Elimination of possibilities until only one or a very few remain. Hypotheses are testable statements that must be true if a theory is true, thus if the hypothesis is not true, the theory can be deducted from the set of possible theories.

7. Data Hypothesis Theory Pass Beliefs Induction Fail The Scientific Method Deduction Test (Experiment)

8. ©2001 Timothy G. Standish Error Data The Scientific Method Does Not Always Provide Definitive Answers Truth Time Present Science Old Theory

9. ©2001 Timothy G. Standish Nucleic Acids The double-stranded nucleic acid 2’Deoxyribonucleic Acid (DNA) serves as the genetic material for all living organisms Other particles that exhibit some, but not all, of the characteristics of life, viruses and viroids, also use nucleic acids as their genetic material but in addition to double-stranded DNA may use single- stranded DNA or Ribonucleic Acid (RNA) The structure of nucleic acids reveals both why they are excellent molecules for information storage and transmission

10. ©2001 Timothy G. StandishContingency DNA and RNA exhibit no apparent preference for any sequence of monomers, thus they exhibit a property sometimes called “contingency” To efficiently code information symbols, sounds or other media used must be made up of elements whose sequence is independent of any physical or chemical constraints The monomers joined together to make nucleic acids are like letters in the English language, nothing prevents the letters from being arranged in any sequence to create an almost infinite set of words, sentences, paragraphs etc. Because nucleic acids are made up of subunits whose sequence is uninfluenced by chemical interactions between the subunits they excel as information storage molecules

11. DNA mRNA Transcription Introduction The Central Dogma of Molecular Biology Cell Polypeptide (protein) Translation Ribosome ©1998 Timothy G. Standish

12. OH O CH 2 Sugar H H H A Nucleotide Adenosine Mono Phosphate (AMP) OH NH 2 N N N N Base P O OH HO O Phosphate 2’3’ 4’ 5’ 1’ Nucleotide Nucleoside H+H+ -

13. Pyrimidines NH 2 O N N NH N Guanine N N Adenine N N NH 2 N O N O N Cytosine Purines Uracil (RNA) CH 3 N O N O NH N O N O Thymine (DNA)

14. N O H N O N N H Cytosine H O N N N N N H H Guanine - + + + - - Base Pairing Guanine And Cytosine

15. CH 3 N O N O N H + - Thymine N N N N H N H - + Adenine Base Pairing Adenine And Thymine

16. Base Pairing Adenine And Cytosine N O H N O N N H Cytosine - + - N N N N H N H - + Adenine

17. Base Pairing Guanine And Thymine CH 3 N O N O N H + - Thymine H O N N N N N H H Guanine + + -

18. ©2001 Timothy G. Standish SUGAR-PHOSPHATE BACKBONE H P O HO O O CH 2 HOH P O O HO O O CH 2 H P O OH HO O O CH 2 NH 2 N N N N O O N NH N N N O NH 2 N B A S E S DNADNADNADNA O H P O HO O O CH 2 HO O H2NH2N N HN N N H H P HO O O CH 2 O O N O H2NH2N N H H2OH2O HOH P O HO O O CH 2 CH 3 O O HN N H2OH2O 5’Phosphate group 3’Hydroxyl group 5’Phosphate group 3’Hydroxyl group Because of specific base paring, any single- stranded sequence of DNA or RNA can be used as a template for production of the complimentary strand

19. ©2001 Timothy G. Standish The Watson - Crick Model Of DNA 3.4 nm 1 nm 0.34 nm Major groove Minor groove A T T A G C C G G C T A A T G C T A A T C G - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

20. ©2001 Timothy G. Standish Forms of the Double Helix 0.26 nm 2.8 nm Minor groove Major groove C G A T T A G C C G G C T A A T G C T A A T C G A T G C 1.2 nm A DNA 1 nm Major groove Minor groove A T T A G C C G G C T A A T G C T A A T C G 0.34 nm 3.9 nm B DNA +32.7 o Rotation/Bp 11 Bp/turn -30.0 o Rotation/Bp 12 Bp/turn +34.6 o Rotation/Bp 10.4 Bp/turn C G G C C G G C G CG C C G G C C G 0.57 nm 6.8 nm 0.9 nm Z DNA

21. ©2001 Timothy G. Standish C-DNA: –Exists only under high dehydration conditions –9.3 bp/turn, 0.19 nm diameter and tilted bases D-DNA: –Occurs in helices lacking guanine –8 bp/turn E-DNA: –Like D-DNA lack guanine –7.5 bp/turn P-DNA: –Artificially stretched DNA with phosphate groups found inside the long thin molecule and bases closer to the outside surface of the helix –2.62 bp/turn Even More Forms Of DNA B-DNA appears to be the most common form in vivo. However, under some circumstances, alternative forms of DNA may play a biologically significant role.

22. ©2001 Timothy G. Standish Negatively (twisting to the left) supercoiled DNASupercoiling Opening negatively supercoiled DNA may contribute to strand separation Opened negatively supercoiled DNA Open circle DNA with no supercoiling

23. ©2001 Timothy G. Standish DNA Structure Influences Migration Through Gels

24. Distribution Of Negative Charge Prevents DNA Annealing

25. NaCl Cl - Na + Salts Allow DNA Annealing Cat ions can cancel out the negative charge carried on the sugar phosphate backbone.

26. Na + Salts Allow DNA Annealing Na +

27. O H P O O O CH 2 O H2NH2N N HN N N H P O-O- O O CH 2 O O N O H2NH2N N HOH P O O-O- O O CH 2 CH 3 O O HN N O-O- O-O- Salts Allow DNA Annealing H P O -O-O O O CH 2 HOH P O O -O-O O O CH 2 H P O O-O- -O-O O O NH 2 N N N N O O N NH N N N O NH 2 N Na +

28. ©2001 Timothy G. Standish Hybridization The bases in DNA will only pair in very specific ways, G with C and A with T In short DNA sequences, imprecise base pairing will not be tolerated Long sequences can tolerate some mispairing only if -  G of the majority of bases in a sequence exceeds the energy required to keep mispaired bases together Because the source of any single strand of DNA is irrelevant, merely the sequence is important, DNA from different sources can form a double helix as long as their sequences are compatible Thus, this phenomenon of base pairing of single-stranded DNA strands to form a double helix is called hybridization as it may be used to make hybrid DNA composed of strands which came from different sources

29. ©2001 Timothy G. Standish Hybridization DNA from source “Y” TACTCGACAGGCTAG CTGATGGTCATGAGCTGTCCGATCGATCAT DNA from source “X” TACTCGACAGGCTAG Hybridization

30. ©2001 Timothy G. Standish Hybridization Because DNA sequences will seek out and hybridize with other sequences with which they base pair in a specific way much information can be gained about unknown DNA using single-stranded DNA of known sequence Short sequences of single-stranded DNA can be used as “probes” to detect the presence of their complimentary sequence in any number of applications including: –Southern blots –Northern blots (in which RNA is probed) –In situ hybridization –Dot blots... In addition, the renaturation or hybridization of DNA in solution can tell much about the nature of organism’s genomes

31. ©2001 Timothy G. Standish Inverted Repeats Inverted repeat Single-stranded DNA or RNA

32. ©2001 Timothy G. Standish Inverted Repeats

33. ©2001 Timothy G. Standish Inverted Repeats

34. ©2001 Timothy G. Standish 5’ TGCTAATACGCGATCAGCGCGTACTGGTAT 3’ Inverted Repeats 5’ TGCTAATACGCGATCAGCGCGTACTGGTAT 3’ Inverted repeat

35. ©2001 Timothy G. Standish Inverted Repeats 5’ AUGCUAAUACGCG-CGCGUACUGGUAUC 3’ A C G AU ∆G = Energy released in base pair formation (∆G x ) + Energy required to bend loop (∆G u ) =>-2.0 kcal/mol + 4.4 kcal/mol =>+2.4 kcal/mol  not spontaneous/unlikely

36. ©2001 Timothy G. Standish Inverted Repeats 5’ AUGCUAAUACGC-GCGUACUGGUAUC 3’ G-CG-C A C G AU

37. ©2001 Timothy G. Standish Inverted Repeats 5’ AUGCUAAUACG-CGUACUGGUAUC 3’ C-GC-G G-CG-C A C G AU

38. ©2001 Timothy G. Standish Inverted Repeats 5’ AUGCUAAUAC-GUACUGGUAUC 3’ C-GC-G G-CG-C G-CG-C A C G AU

39. ©2001 Timothy G. Standish Inverted Repeats 5’ AUGCUAAUA-UACUGGUAUC 3’ C-GC-G G-CG-C G-CG-C C-GC-G A C G AU

40. ©2001 Timothy G. Standish Inverted Repeats Much of the -∆G from base pairing comes from base stacking excluding water and thus hydrophobic interrelations between bases. ∆G is calculated in terms of base stacking. +4.4 Hairpin loop (∆G u ) -2.0 CG/GC-3.4 GC/CG-2.0 GC/CG -2.1 AC/UG -1.1 UA/AU A-UA-U G-CG-C G-CG-C C-GC-G C-GC-G ACG AU 5’ AUGCUAAU-ACUGGUAUC 3’  ∆G x =-10.6  ∆G x +  ∆G u = With a series of stacked base pairs due to an inverted repeat, the formation of a duplex becomes thermodynamically likely: ∆G u = Energy required to hold bases in an unpaired state (positive) ∆G x = Energy released by base pair formation (negative) -10.6 + 4.4 = -6.2 kcal/mol  Stable ∆G =

41. ©2001 Timothy G. Standish Base Stacking N N N N H H N Adenine Uracil N H N O N O N N N N H H N Adenine Uracil N H N O N O 5’ 3’ 5’ 3’ 5’ AA 3’ 3’ UU 5’

42. ©2001 Timothy G. Standish N N N N H H N Adenine Uracil N H N O N O N N N N H H N Adenine Uracil N H N O N O 5’ 3’ 5’ 3’ 5’ AU 3’ 3’ UA 5’ Base Stacking

43. ©2001 Timothy G. Standish Double-Stranded Inverted Repeats

44. ©2001 Timothy G. Standish Double-Stranded Inverted Repeats

45. ©2001 Timothy G. Standish Double-Stranded Inverted Repeats

46. ©2001 Timothy G. Standish AZT 3’-Azido-3’-deoxythymidine N3N3 O CH 2 Deoxy ribose H OH CH 3 N O N O NH Thymine

47. ©2001 Timothy G. Standish