1. Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

2. Overview  Brief review of clinical features  Learning the language: chromosomes, genes  What are genes?  How does Turner syndrome happen?  X-inactivation: is it important?  Types of Turner syndrome  How to read a karyotype  Fun facts about the X chromosome

3. http://musom.marshall.edu/graphicdesign/ibooks/Genetics.html Goodman RM, Gorlin RJ. The Malformed Infant and Child. Oxford University Press. 1983.

10. What are genes?  Genes give instructions to the body to make certain products, structures, etc.  Eg. Hair colour, height, organs  ~30,000 genes in our body  Present in almost every cell  Many genes need to work in pairs, but some only need one functional copy

11. Another way to think about genes…  English alphabet: A, B, C, D, E,…  Example of English sentence: A cat in the hat.  DNA alphabet: C, G, A, T,…  Example of DNA code: CGATTATGTGCATTGCCCCAT… Code for SHOX gene

12. Another way to think about DNA…  Gene working properly. A cat in the hat.  Gene with half its function. A cat in the hot. A cat in the hat.  Gene cannot give proper instructions. A cat in the hot.

13. With some genes on the X chromosome  Gene working properly. A cat in the hat.  Gene cannot function properly. A cat in the hat. But… not enough! This is also called ‘haploinsufficiency’

14. How does Turner syndrome happen?  Remember high school Biology?  ‘Reproductive cycles of the cell’?

17. What are the chances of this happening in another pregnancy?  Most cases happen by chance; recurrence risk is considered to be low.  For women WITH Turner syndrome, the risk of having children with Turner may be increased depending of the individual karyotype (for those who can conceive naturally)

18. X-inactivation  Happens to all individuals with more than one X chromosome  Eg. 46,XX; 47,XXX; 47,XXY  ONLY 1 X chromosome remains completely active  The other X chromosomes becomes permanently inactive *This makes sense if you think about males having only one X chromosome *Some genes stay active on both X chromosomes (or X and Y in males)

19. (1)

20. How is this important for Turner syndrome?  Some genes stay activated on both chromosomes  If there is only one X chromosome, genes cannot work in pairs properly  This disruption of instructions leads to the symptoms we see in Turner syndrome

21. Important genes on the X chromosome  SHOX: bone development and growth  Xp11: short stature; ovarian delvelopment impaired in approx. 50 %  Xq13, POF, BMP15: ovarian development  Many genes have unknown function

22. ‘Types’ of Turner syndrome  Reminder: There is a lot of variability of symptoms regardless of the type  ‘Classic’: Typically individuals who are missing one entire X chromosome  ‘Partial’: Individuals with a part of the X chromosome missing, or structural changes of one X chromosome  ‘Mosaic’: Individuals with two X chromosomes in some cells, and others with only one X chromosome

23. Examples  45, X  45, X/46, XX  45, X/46,X,r(X)  45,X/46,X,del(Xp)  45, XO  46,X,dup(X) Classic TS Mosaic TS Structural variant TS Mosaic TS + Structural variant

24. Relative Frequencies of Turner Syndrome Karyotypes Standard monosomy 45,X46 % X mosaicismX/XX, X/XXX7 % Isochromosome Xq 45,X/46,X,i(Xq) 46,X,i(Xq) 18 % Ring45,X/46,X,r(X)16 % Deletion Xp45,X/46,X,del(Xp) 46,X,del(Xp) 5 % Structural abnormality of Y 6 % Other2 % Jacobs et al. (1997).

25. So… how DO you read a karyotype? Total # of chromosomes Sex chromosomes

26. So… how DO you read a karyotype? Total # of chromosomes Sex chromosomes # of colonies analyzed Mosaicism Abbreviation for structural change Eg. DUP > duplication DEL > deletion IDIC > isodicentric r > ring i > isochromosome Description of where the structural change is

27. Structural changes

28. Structural changes (con’t)

31. Fun Facts About the X Chromosome  X chromosome represents about 5 % of total DNA  X chromosome likely has 800-900 genes (~30,000 genes in the genome)  75-80 % of cases, the single X chromosome comes from the egg  Males cannot survive without an X chromosome (45,Y does not exist)

32. Thank-you!

33. Bibliography  Alberts B, Johnson A, Lewis J, et al. Molecular Biology of the Cell. 4th edition. New York: Garland Science; 2002.Garland Science  Gardner RJM, Sutherland GR. 3rd edition. Chromosome abnormalities and genetic counseling. Oxford Univeristy Press. 2004.  Goodman RM, Gorlin RJ. The Malformed Infant and Child. Oxford University Press. 1983.  Zhong Q, Layman LC. Genetic considerations in the patient with Turner syndrome--45,X with or without mosaicism. Fertil Steril. 2012 Oct;98(4):775- 9. Fertil Steril.