1. Measuring Genetic Variation in Natural Populations Historical Method: Examining protein variation via electrophoresis Modern Method: DNA sequencing and typing

2. More than one allele at 30-50% of all loci in a population. Such loci are called polymorphic. LDH-B cline in Fundulus

3. Most populations harbor considerable genetic diversity Heterozygosity 0.100.200.30

4. Heterozygosity has a couple of interpretations: 1)Average percentage of loci that are heterozygous per individual. or 2)Average percentage of individuals that are heterozygous per loci.

5. DNA Sequencing : How is it done? Heat : Single strands separate Primer Anneals Only use one primer DNA polymerase All possible DNA fragments are synthesized ATGCTAACGCCATTCGA T TATA TAC TACG TACGA TACGAT 2 kinds of nucleotides (1) Regular Nucleotides (2) Fluorescent (ACGT) terminating nucleotides Double Stranded DNA ATGCTAACGCCATTCGA TACGATTGCGGTAAGCT

6. Laser TACGAT TACGA TACG TAC TATA T (-) Cathode (+) Anode Gel Electrophoresis Synthesized DNA T AC Computer Interprets Fluorescent Code

7. TTCTTCAGGGGAGGGGGTGGAANATAAAAACAAAAACCCTACAATGTATATTCATCGCCCATAATCGGCTACTTAGACA Electropherogram DNA Sequence Data From Automated Sequencer

8. Another Way to Isolate Genes : Polymerase Chain Reaction (PCR) HeatSingle Strands Separate Heat Double Stranded DNA Heat Resistant DNA Polymerase makes new strands Primers Anneal Primers Anneal Two DNA fragments are produced

9. PCR 123 Cycles 4 Copies 2 4 8 16 etc DNA is Amplified

10. Anode (+) Cathode (-) An Agarose Gel DNA Base Pairs 1000 600 300

12. (75 x 2) + (24) / (102 x 2) = 85.3 75/102 + 1/2 (24/102) = 85.3 Counting alleles or Genotypic frequencies

13. Sequencing Studies Have Revealed Enormous Genetic Diversity CFTR Locus

14. Population Genetics Evolution depends upon mutation to create new alleles. Evolution occurs as a result of population level changes in allele frequencies. What evolutionary forces alter allele frequencies?

15. How do allele frequencies change in a population from generation to generation?

16. Hardy-Weinberg Principle (1)Allele frequencies in a population will not change, generation after generation. (2)If allele frequencies are given by p and q, the genotype frequencies will be given by p 2, 2pq, and q 2. When none of the evolutionary forces (selection, mutation, drift, migration, non-random mating) are operative:

17. Allele frequencies in the gene pool: A: 12 / 20 = 0.6 a: 8 / 20 = 0.4 Alleles Combine to Yield Genotypic Frequencies

18. Our mice grow-up and generate gametes for next generations gene pool

19. Allele frequency across generations: A General Single Locus, 2 Allele Model Freq A 1 = p Freq A 2 = q

20. One locus, 2 Allele Model GenotypeA 1 A 1 A 1 A 2 A 2 A 2 Frequency of allele A 1 = p Frequency of allele A 2 = 1 - p = q In a diploid organism, there are two alleles for each locus. Therefore there are three possible genotypes: Given: Then: GenotypeA 1 A 1 A 1 A 2 A 2 A 2 Frequencyp 2 2pqq 2 A population that maintains such frequencies is said to be at Hardy-Weinberg Equilibrium

21. Hardy-Weinberg Principle (1)Allele frequencies in a population will not change, generation after generation. (2)If allele frequencies are given by p and q, the genotype frequencies will be given by p 2, 2pq, and q 2 When none of the evolutionary forces (selection, mutation, drift, migration, non-random mating) are operative:

22. Hardy-Weinberg Principle Depends Upon the Following Assumptions 1.There is no selection 2.There is no mutation 3.There is no migration 4.There are no chance events 5.Individuals choose their mates at random