1. Transcription, Translation & Protein Synthesis

2. Protein Synthesis Protein synthesis - a cell makes protein based on the message contained within its DNA. However: –DNA is only found in the nucleus –Proteins are only made outside the nucleus – in the cytoplasm. RNA – is used to carry these messages.

3. Ribonucleic Acids (RNA) There are three types of RNA: 1.mRNA – carries a message from the DNA to the ribosome 2.tRNA – transports amino acids to the mRNA to make a protein 3.rRNA – make up ribosomes, which make protein.

4. Ribonucleic Acids (RNA) RNA is almost exactly like DNA, except: 1. RNAsugar ribose 1. RNA has a sugar ribose DNAsugar deoxyribose DNA has a sugar deoxyribose RNAuracil (U) 2.RNA contains uracil (U) DNAthymine (T) DNA has thymine (T) RNAsingle-stranded 3.RNA is single-stranded DNAdouble-stranded DNA is double-stranded

5. Ribonucleic Acids (RNA)

6. Protein Synthesis Occurs in TWO steps: 1.Transcription –information from a strand of DNA is copied into a strand of mRNA 2.Translation – the mRNA, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein)

7. The Central Dogma This order of events is called the central dogma of molecular biology: DNARNA P R O T E I N

8. Step One: Transcription 1.DNA unzips 2.Bases pair up: Free bases in the cell find their complementary bases along the new strands. What will be different?? 3.New backbone formed: What will be different??

9. Step One: Transcription Watch this simplified animation: –Transcription AnimationTranscription Animation

10. Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA

11. Step Two: Translation 1.Divide the mRNA sequence into codons. 2.Codons are three-base sections of mRNA: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

12. Step Two: Translation Watch this simplified animation: –Translation AnimationTranslation Animation

13. Step Two: Translation 2.You need to figure out what amino acid matches up with each codon: ? AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

14. tRNA A go-getter. Gets the right amino acids to make the right protein according to mRNA instructions It contains anti-codons EX: UAC – mRNA – AUG – tRNA

15. The Genetic Code

16. Step Two: Translation 2.Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: met AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA asp???argthraspargser

17. Step Two: Translation 2.Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: met AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA aspSTOPmetthraspargser

18. RECAP: 1.DNA is transcribed into mRNA in the nucleus. 2.The mRNA leaves the nucleus and enters the cytoplasm. 3.The protein is translated from the mRNA sequence using tRNA and amino acids.