1. Why is DNA considered the “code of life”? Read the handout and write one paragraph (at least 5 sent.) that answers this question. 12/17/15 Date:12/17/15Topic:The Central DogmaPage # ___

2. Today in Room 326/311… HW: Protein Synthesis Worksheet CONTENT OBJ: SW replicate, transcribe, and translate DNA LANG. OBJ: SW explain verbally and in writing why DNA is the “code of life” ANNOUNCEMENTS: Progress Reports tomorrow- take home AGENDA: Admit Slip: Why is DNA the code of life? (10 min) -check yesterday’s work Replication Overview/Demo (20 min) Transcription (10 min) Translation (10 min) Practice (20 min) Revisit: Why is DNA the code of life? (10 min) Date:12/17/15Topic:The Central DogmaPage # ___

3. DNA as the “Code of Life” Volunteers to read responses In short… The 4 nitrogenous bases (A, T, C, G) are “read” in groups of 3 (known as a codon) by enzymes that turn those “words” into proteins, those proteins determine who we are (how we look, act, etc.)

4. “Why We Care”: From DNA to Proteins Watch Video “Introduction to Protein Synthesis” https://www.youtube.com/watch?v=suN- sV0cT6c https://www.youtube.com/watch?v=suN- sV0cT6c

5. The Central Dogma of Biology* Dogma = A belief known to be absolutely true “Central Dogma of Biology”: We need to go through all of these steps today!

6. DNA Replication Review and continue… Watch “DNA Replication Process 3D Animation” Let’s learn the “players” (enzymes) in the process…

8. Set up class visual diagram Step 1 of Replication* Replication Fork Helicase unwinds the double helix at the replication fork

9. Step 2* SSB = Single-Stranded Binding Proteins Annealing = To stick together (Prevents from re-annealing) SSBs (binding proteins) keep DNA strands separated

10. Step 2 Cont.* Two replication forks create a replication bubble

11. Step 3* Primase (RNA Polymerase) RNA Primer Primase = enzyme that lays down an RNA primer; must occur for replication to begin RNA Primer = small series of nucleotides that allows replication to begin Primase lays down an RNA primer (allows replication to begin)

12. Step 4* DNA Polymerase = enzyme that lays down nucleotides in 5’ to 3’ direction Sliding clamp = holds DNA Poly. to template strand DNA polymerase lays down nucleotides in 5’ to 3’ direction

13. Step 4 Cont.* Leading strand is synthesized (created) continuously Lagging strand is synthesized discontinuously, in sections called Okazaki fragments

14. Step 5* Primers are removed

15. Step 6* DNA polymerase fills in the gaps with nucleotides

16. Step 7* Ligase connects (ligates) the Okazaki fragments

17. Two new strands!

18. Central Dogma Step 1 Complete!

19. Practice… Replicate this DNA in your journal… AGCGTAGCTTATCGCATCGAAT Should end up with two DNA chains!

20. Answer… AGCGTAGCTTATCGCATCGAATTCGCATCGAATAGCGTAGCTTA Semi-conservative replication

21. Transcription… Very similar to DNA replication, except… Instead of DNA polymerase adding nucleotides Now RNA polymerase adds nucleotides Instead of the new daughter strand of DNA pairing with the parent strand in the nucleus The new daughter strand is mRNA (messenger RNA), and is sent off to the cytoplasm DNA  RNA

22. Watch: “From DNA to Protein” until 1:33

23. Change of Nucleotides In DNA replication, A pairs with T and C pairs with G But in RNA transcription, Thymine is replaced with Uracil So A pairs with U and C pairs with G

24. Practice Transcribing DNA First! Replicate the DNA strand… Now, transcribe the bottom strand into mRNA Note, all Thymine’s have been replaced by Uracil’s

25. Transcription* DNA is transcribed into mRNA (messenger RNA) RNA polymerase is the enzyme Thymine is replaced by Uracil A pairs with U C pairs with G mRNA is made in nucleus and sent to cytoplasm

26. Video Review From DNA to Protein: https://www.youtube.com/watch?v=gG7uCskUOrA (Watch first half only) https://www.youtube.com/watch?v=D3fOXt4MrOM (watch first half only)

27. Interpret this picture. What does this image represent? Describe in at least 3 sentences.

28. Practice Worksheet

29. Exit Ticket Using your new knowledge, again answer the question in one paragraph: “Why is DNA considered the Code of Life?”

30. Describe what is happening in this visual, using at least 7 vocab words listed. 12/18/15

31. Today in Room 326/311… HW: Mutations Practice Worksheet CONTENT OBJ: SW replicate, transcribe, and translate DNA LANG. OBJ: SW write vocab notes, discuss in pairs, listen to video, and read powerpoint slides AGENDA: AS: What does this visual represent? (10 min) Translation (15 min) Overview- Review/Video (10 min) Worksheet practice (20) min Mutations (15 min) Mutations Video (10 min) Date:12/18/15Topic:The Central Dogma 2Page # ___

32. The Central Dogma* Remember: In replication, DNA  DNA using A, T, C, G In transcription, DNA  RNA, using A, U, C, G

33. Reading the Code Finish Video: From DNA to Protein

35. Translation* Ribosome reads the mRNA and translates it unto tRNA (transfer RNA) Base pairing still the same  A w/ U and C w/ G Ribosome reads the tRNA 3 letters at a time (codon) Adds the correct amino acid for each codon Chain of amino acids = protein

36. Turning tRNA into protein

37. From DNA to Protein https://www.youtube.com/watch?v=gG7uCskUO rA https://www.youtube.com/watch?v=gG7uCskUO rA1:35-2:41

38. Ribosome* “Protein factory” 3 binding sites: A, P, E Attaches to mRNA (messenger RNA) Creates polypeptide chain (linked amino acids) Draw this!!!

39. Building a Polypeptide tRNA (transfer RNA) holding amino acid attaches at A site tRNA moves to P site; amino acid attaches to growing chain Now empty tRNA moves to E site, lets go 123 Label the 1, 2, 3 on your first drawing

40. Start and Stop Ribosome only begins translation when it finds the start codon = “AUG” ** Ribosome stops translating when it hits a stop codon such as UAA, UAG, or UGA ** Polypeptide chain is released  folds to form a protein

41. The Central Dogma Remember: In replication, DNA  DNA using A, T, C, G In transcription, DNA  RNA, using A, U, C, G In translation, mRNA  tRNA  using A, U, C, G tRNA  amino acids using triplet code

42. What is the Central Dogma?? Answer without looking!! DNA Replication Transcription (DNA  RNA) Translation (RNA  Proteins) Overall: DNA  RNA  Proteins

44. Machinery Reads the DNA template strand to create a complementary DNA strand __________________ Reads the DNA template strand to create a complementary RNA strand __________________ Reads the RNA strand to create the corresponding amino acids __________________

45. Overview Video Real Time replication/transcription/translation https://www.youtube.com/watch?v=gG7uCskUO rA https://www.youtube.com/watch?v=gG7uCskUO rA

46. Your Turn!! Tape this in your journal!

47. Final Practice- Protein Synthesis

48. What happens when something goes wrong?? Mutations!! In pairs, make a list of everything that comes to mind when you think of the word “mutant”

49. Class Shareout

50. Recall: Central Dogma

51. Mutations* Changes in the DNA sequence Leads to changes in the mrNA May change protein May change trait

52. Types of Mutations* Point mutation Change to ONE letter (base) in the DNA May change protein Examples… (  will write examples below)

53. Point Mutation (one base change)

54. Types of Point Mutations Nonsense mutation* = change to STOP Protein ends up much shorter than intended (fewer amino acids)

55. Types of Point Mutations* Missense mutation Changes amino acid* Example: GCA  Ala But if mutation occurs and GCA becomes GUA GUA  Val

56. Missense Mutation Ex.* Sickle Cell Anemia* Normal red blood cells Sickle Cells

57. Types of Point Mutations Silent mutation* = no change to protein If there is a change in the base code, why doesn’t the protein switch?

58. Types of Mutations* Point mutation Change to ONE letter (base) in the DNA May change protein Examples… Frameshift mutation Addition OR deletion of one base Shift DNA frame (changes codons) Big changes to protein! Examples…

59. Frameshift Mutations Frameshift: Add or delete one or more bases

60. Types of Frameshift Mutations Insertion = add one or more bases* How much does it change the protein? A lot!

61. Types of Frameshift Mutations Deletion = lose one or more bases* How much does this change the protein? A lot!

62. Deletion Example Cystic Fibrosis

63. The Science of Mutations https://www.youtube.com/watch?v=qVmusHZtQ ms https://www.youtube.com/watch?v=qVmusHZtQ ms

64. Mutations Practice Wrksheet