2. NUCLEIC ACIDS REMEMBERED

3. TRANSFORMATION Definition: process in which genetic characteristics of an organism are changed due to the absorption of DNA from a lysed bacterial cell. Griffith’s experiment: proved transformation occurs but did not identify the “transforming agent”

4. AVERY, MACLEOD, MCCARTY Series of experiments to determine transforming factor; a) Mixed live non-virulent cells with different cell parts individually; only DNA caused transformation b) Used combinations of DNA components- NO TRANSFORMATION c) Ribonucleases & proteases – no effect on transformation; deoxyribonucleases inhibited transformation Conclusion: DNA (whole molecule) transforming factor

5. Bacteriophage virus that infects bacterial cells

6. Lederberg & Zinder TRANSDUCTION  Transmission of genetic material by a virus  Resistant bacteria receive a new gene, transferred by the virus (from 1 st host)

7. HERSHEY & CHASE Radioactive isotopes (sulfur & phosphorus): prove that the DNA of the phage enters the cell, protein coat remains outside the cell

8. LEDERBERG & TATUM Conjugation – sexual reproduction in bacteria, leads to genetic recombination 2 strains of DNA grown together – one has traits (A,B,C) other has (D,E,F) Cytoplasmic bridge (pilus) forms and cells exchange plasmid Offspring (recombinants) have traits of both parents (A,B,C,D,E,F)

9. DNA ERWIN CHARGAFF: analyzed nuclei of many species  Base pairing rules (1:1 ratios)  Concentration of cytosine & guanine equal  Concentration of adenine & thymine equal ROSALIND FRANKLIN & MAURICE WILKINS ‒ X-ray diffraction WATSON & CRICK ‒ DNA Model ‒ Proposed semi conservative replication

11. Double helix Double strand of nucleotides (deoxyribose, phosphate, nitrogen base) held together by H-bonds Anti-parallel strands Purines: adenine & guanine (double rings) Pyrimidines: thymine & cytosine (single rings) DNA STRUCTURE

12. NOTE: # of H-bonds between bases, measurements, anti-parallel strands

14. DNA REPLICATION

18. Given one strand of DNA, what is the base sequence of the complimentary strand? ACGTTGCAAGCTGACCTGGTCAG

19. REPLICATION MODELS

20. MESELSON & STAHL PROVE SEMICONSERVATIVE REPLICATION

21. DNA has two “heavy” strands DNA is now hybrid; ½ heavy, ½ light

22. MESELSON & STAHL PROVE SEMICONSERVATIVE REPLICATION Conservative replication proven wrong. Semi-conservative & dispersive still possible (all strands hybrids)

23. MESELSON & STAHL PROVE SEMICONSERVATIVE REPLICATION After another replication (on “light” medium), semi- conservative replication confirmed (1/2 hybrid & ½ light) Predict the next generation!

25. DNA replication: - DNA polymerases catalyze the reaction - Hydrolysis of phosphate bonds provides energy

26. DNA: anti-parallel strands Carbons of deoxyribose numbered 1' - 5' Phosphodiester bonds involve the 3' & 5' carbons One strand runs 5' to 3' The other strand runs 3' to 5'

27. 1. DNA polymerase elongates DNA strands only in the 5' to 3' direction 2. One new strand, the leading strand, can elongate continuously 5' to 3' as the replication fork continues. 3. The other new strand, lagging strand, grows discontinuously in an overall 3' to 5' direction by adding short Okazaki fragments that are built in a 5' to 3' direction. 4. Ligase connects the Okazaki fragments.

28. Priming DNA Synthesis Polymerase cannot initiate synthesis, it can only add to the end of an already started strand. Primase builds RNA nucleotides into a primer. RNA primer eventually replaced by DNA nucleotides

29. (topoisomerase)

30. Summary of DNA Replication Ligase joins Okazaki fragments Lagging strand- discontinuous synthesis – Okazaki fragments Helicase unwinds parental double helix Topoisomerase stabilizes unwound DNA Leading strand, continuous synthesis

31. DNA REPLICATION & MAINTENANCE DNA Polymerase: enzyme which synthesizes single DNA strand from template DNA (replication) Whole nucleotides are bonded to complementary nucleotides to form each new strand. –Trinucleotides are raw materials (ATP, GTP, TTP, CTP) –2  (high energy bonds) used to accomplish bonding (energy expensive); AMP, GMP,TMP,CMP bonded to each other by DNA polymerase. Other enzymes involved in maintaining DNA structure. –Recognition enzymes (proof reading enzymes) scan DNA molecule to identify atypical or injured DNA –Endonucleases (restriction enzymes) – breaks DNA above & below “atypical” sites. –DNA polymerase – synthesizes single strand segments to replace “damaged” segments. –DNA ligase – binds new segment to old strand.

32. ENZYMES WHICH MAINTAIN DNA “Scanner” or proofreading enzyme checks DNA for damage Endonuclease (restriction enzyme) cuts DNA DNA Polymerase adds new nucleotides DNA Ligase joins new nucleotides (S-P) links Okazaki fragments

33. The end-replication problem: Gap left at the 5’ end of each chromosome. Each end gets shorter with every replication Telomeres -short nucleotide sequences at the end of each chromosome. - protect the genes - telomerase, present in germ cells, produces telomeres Humans: TTAGGG