Presentation is loading. Please wait.

Presentation is loading. Please wait.

Department of Psychology

Published byVictoria Foster Modified over 9 years ago

Similar presentations

Presentation on theme: "Department of Psychology"— Presentation transcript:

1 Department of Psychology
Epigenetic Impact of Toxins, Stress & Social Interactions: Transgenerational Perspectives Dr. Frances A. Champagne Department of Psychology Columbia University

2 Our changing brain…

3 HOW DOES THIS OCCUR? Epigenetic Control of Gene Activity
Early Environmental Experiences Brain Physiology Behavior Our experiences or “nurture” can have long-term effects on our brain and behavior Genes can be turned “on” or turned “off” through epigenetic changes HOW DOES THIS OCCUR?

4 OFFSPRING DEVELOPMENT
Parental Experience Influences Offspring Development MATERNAL EXPERIENCES stress, toxin exposure, nutritional status oocyte transcription/translation prenatal environment placental function, physiology postnatal maternal behavior sensory stimulation, frequency & stability of care OFFSPRING DEVELOPMENT

5

6 Programming of Fetal Stress Response
maternal fetal risk of prematurity lower birth weight increased stress response risk of depression & anxiety Stress

7 Pathways of Prenatal Stress Effects
Monk, Spicer & Champagne (2012) Development & Psychopathology

8 Prenatal Stress Effects on Epigenetics & Fetal Neurodevelopment
Catherine Monk & Ben Tycko

9 Genes Altered in the Rat Placenta Following Chronic Variable Exposure to Stress
Gene Function Stress Effect 11BHSD-2 metabolizes corticosterone Decreased DNMT1 maintenance DNA methyltransferase Nr3c1 glucocorticoid receptor Decreased in male 11BHSD-1 AFP Alfa-fetoprotein (binds estradiol) AR Androgen receptor Decreased in females AVPR1a Vasopressin receptor (social behavior) Decreased in males DIO3 Iodothyronine deiodinase 3 (inactivates thyroid hormone) DLK1 Delta-like 1 homolog (adipogenesis) DNMT3L DNA methyltransferase IGF1R Insulin growth-like factor 1 receptor IGF2 Insulin growth-like factor 2

10 11BHSD-2 DNA Methylation in the Placenta
Prenatally Stressed Non-Stressed cccctctgctagtgtgacacacttcgcgcaactccgcagttggcgggcgcggaccacccctgcggctctgccggctggctgtcaccctcgggggctctggctgccgacccacgggcgggctccgagcggttccaagcctcggagtgggcgggggcg ggaggg agcctggg agaa M cccctctgctagtgtgacacacttcgcgcaactccgcagttggcgggcgcggaccacccctgcggctctgccggctggctgtcaccctcgggggctctggctgccgacccacgggcgggctccgagcggttccaagcctcggagtgggcgggggcg ggaggg agcctggg agaa

11 Anita Thapar & colleagues

12 Prenatal Exposure to Bisphenol A (BPA)
DNA Methylation Prenatal Exposure to Bisphenol A (BPA) Tissue specific changes in gene expression neurodevelopmental, metabolic, immune outcomes

13 maternal exposure to bisphenol A (BPA) during pregnancy
tissue specific changes in gene expression SEX-SPECIFIC EFFECTS Boys: high prenatal BPA exposure associated with increased behavior problems (CBCL), including scores on Emotionally Reactive and Aggressive Behavior syndromes Girls: prenatal BPA exposure associated with lower scores on all syndromes, particularly Anxious/Depressed and Aggressive Behavior neurodevelopmental, metabolic, immune outcomes

14 Placental Gene Expression
Exposures: vehicle/control (corn oil) 2µg/kg low dose BPA 20µg/kg low dose BPA 200µg/kg low dose BPA Placental Gene Expression DNMT3L IGF2 PEG3

15 Hippocampal-Dependent Memory & Gene Expression
BPA x Sex interaction Kundakovic et al. (2015) Proc Natl Acad Sci U S A

16 Are BPA-associated changes in DNA methylation present in both brain and blood?
PN 28 PN 60 BPA x Sex interaction

17 Are BPA-associated changes in DNA methylation present in fetal cord blood?
BPA x Sex interaction Low BPA < 1 µg/L (F=22; M=21) High BPA > 4 µg/L (F=19; M=19)

18 OFFSPRING DEVELOPMENT
Parental Experience Influences Offspring Development MATERNAL EXPERIENCES stress, toxin exposure, nutritional status oocyte transcription/translation prenatal environment placental function, physiology postnatal maternal behavior sensory stimulation, frequency & stability of care OFFSPRING DEVELOPMENT

19 Dose-Dependent Effect of BPA on Postnatal Maternal Behavior
Pup Licking/Grooming Nursing Kundakovic et al (2013) Proc Natl Acad Sci U S A 110(24):

20

21 LG-Associated Changes in Histone Tri-Methylation at Esr1
Jensen-Pena et al. Endocrinology (2013)

22 Mother to Daughter Transmission of Maternal Care
Kundakovic & Champagne (2015) Neuropsychopharmacology REVIEWS

23 Is there a sensitive period for the effects of maternal LG on offspring?
Jensen-Pena et al. Endocrinology (2013)

24 Effect of Neonatal ERα Up-regulation on Juvenile Maternal Sensitization
MPOA VTA Jensen-Pena et al. Developmental Neurobiology (2015)

25 Epigenetic Impact of the Postnatal Parental Care
Kundakovic & Champagne (2015) Neuropsychopharmacology REVIEWS

26 OFFSPRING DEVELOPMENT OFFSPRING DEVELOPMENT
MATERNAL EXPERIENCES PATERNAL EXPERIENCES oocyte prenatal environment ? postnatal maternal behavior paternal care of offspring OFFSPRING DEVELOPMENT OFFSPRING DEVELOPMENT

27 Influence of paternal experience on offspring
Mashoodh et al (2013) PNAS

28 Effects of Paternal Food Restriction on Mothers and Offspring
Offspring assessment Mashoodh et al (2013) PNAS

29 Reproductive Compensation
Effects of Paternal Food Restriction on Female Mate Preference & Discrimination FR CF Reproductive Compensation

30

31 Embryo transfer (ET) prevents the impact of paternal food restriction on maternal outcomes

32 CF vs FR Effects in Embryo transfer (ET) and Natural Mating (NM) Conditions

33 OFFSPRING DEVELOPMENT OFFSPRING DEVELOPMENT
MATERNAL EXPERIENCES PATERNAL EXPERIENCES oocyte prenatal environment germline effects postnatal maternal behavior paternal care of offspring OFFSPRING DEVELOPMENT OFFSPRING DEVELOPMENT

34 OFFSPRING DEVELOPMENT
MATERNAL EXPERIENCES PATERNAL EXPERIENCES oocyte prenatal environment germline effects postnatal maternal behavior paternal care of offspring OFFSPRING DEVELOPMENT

35 Plasticity vs. Stability

36 Extended Evolutionary Synthesis

37 Contrasting views of development
PROGRAMMED CONSTRUCTED

38 Thanks Columbia University
James P. Curley Rahia Mashoodh Cate Jensen Emily Jordan Zoe Donaldson Marija Kundakovic Kathryn Gudsnuk Columbia Center for Children’s Environmental Health Rachel Miller Frederica P. Perera Columbia University Catherine Monk Ben Tycko Canadian Institutes of Health Research NIH Director's New Innovator Award Centers for Children's Environmental Health & Disease Prevention Research

Download ppt "Department of Psychology"

Similar presentations

Why are social factors important in genetics (and vice-versa)? Andrew Pickles University of Manchester Methodological challenges for the Twenty-First Century.

Why are social factors important in genetics (and vice-versa)? Andrew Pickles University of Manchester Methodological challenges for the Twenty-First Century.
Chung S. Park Animal Science Department North Dakota State University November, 2012 Canola Oil and Breast Cancer Research Projects.

Chung S. Park Animal Science Department North Dakota State University November, 2012 Canola Oil and Breast Cancer Research Projects.
Early Human Development as a Social Determinant of Health Clyde Hertzman.

Early Human Development as a Social Determinant of Health Clyde Hertzman.
Myers’ PSYCHOLOGY (7th Ed)

Myers’ PSYCHOLOGY (7th Ed)
Nutrition: A Lifespan Approach, by Simon Langley-Evans. © 2009 Simon Langley-Evans. 1 Learning objectives.

Nutrition: A Lifespan Approach, by Simon Langley-Evans. © 2009 Simon Langley-Evans. 1 Learning objectives.
Chapter 2: Epigenetics of mammalian parenting Recent studies have parenting have indicating that early caregiver-infant interactions can have lasting effects.

Chapter 2: Epigenetics of mammalian parenting Recent studies have parenting have indicating that early caregiver-infant interactions can have lasting effects.
Epigenetics and Culture Kevin Ferriter Mariah Minder.

Epigenetics and Culture Kevin Ferriter Mariah Minder.
Emerging Issues in Adolescence: Implications for Low and Middle Income Countries Robert Wm. Blum MD, MPH, PhD William H. Gates Sr Professor Bloomberg School.

Emerging Issues in Adolescence: Implications for Low and Middle Income Countries Robert Wm. Blum MD, MPH, PhD William H. Gates Sr Professor Bloomberg School.
Vivette Glover Imperial College London

Vivette Glover Imperial College London
1 Stress and Anxiety in Pregnancy and Child Development Thomas G. O’Connor University of Rochester Medical Center PNMC 21 October 2009.

1 Stress and Anxiety in Pregnancy and Child Development Thomas G. O’Connor University of Rochester Medical Center PNMC 21 October 2009.
Chapter 2 – Biological Beginnings

Chapter 2 – Biological Beginnings
CD-EPI.CENTERCD-EPI.CENTER WHEN THE ENVIRONMENT MEETS THE GENETIC! Medicel Meeting Palermo – April 26th 2014.

CD-EPI.CENTERCD-EPI.CENTER WHEN THE ENVIRONMENT MEETS THE GENETIC! Medicel Meeting Palermo – April 26th 2014.
Epigenetic correlates of human socioeconomic status Clyde Hertzman.

Epigenetic correlates of human socioeconomic status Clyde Hertzman.
The efficacy of maternal care in mitigating the long term consequences of prenatal stress in offspring is unclear. To investigate this aspect of development,

The efficacy of maternal care in mitigating the long term consequences of prenatal stress in offspring is unclear. To investigate this aspect of development,
Genetics & Prenatal Development 2/13/07. Prenatal Influences on Development  Both genetic and environmental factors influence prenatal development 

Genetics & Prenatal Development 2/13/07. Prenatal Influences on Development  Both genetic and environmental factors influence prenatal development 
Epigenetics and the brain; the nature of nurture? Anthony Isles Behavioural Genetics Group Cardiff University.

Epigenetics and the brain; the nature of nurture? Anthony Isles Behavioural Genetics Group Cardiff University.
Early programming hypothesis Wilfried Karmaus Reproductive Epidemiology EPI 824.

Early programming hypothesis Wilfried Karmaus Reproductive Epidemiology EPI 824.
LIFE-SPAN DEVELOPMENT

LIFE-SPAN DEVELOPMENT
Substance abuse prevention Gilberto Gerra Chief Drug Prevention and Health Branch.

Substance abuse prevention Gilberto Gerra Chief Drug Prevention and Health Branch.
1 Puberty. 2 “I think that what is happening to me is so wonderful and not only what can be seen on my body, but all that is taking place inside. I never.

1 Puberty. 2 “I think that what is happening to me is so wonderful and not only what can be seen on my body, but all that is taking place inside. I never.

Similar presentations

Ads by Google