Presentation is loading. Please wait.

Presentation is loading. Please wait.

Figure S1. Schematic diagram of vector pU1391W used to study subcellular localization of proteins. RB and LB, right and left T-DNA border;; Hpt, hygromycin.

Published byRuth King Modified over 9 years ago

Similar presentations

Presentation on theme: "Figure S1. Schematic diagram of vector pU1391W used to study subcellular localization of proteins. RB and LB, right and left T-DNA border;; Hpt, hygromycin."— Presentation transcript:

1 Figure S1. Schematic diagram of vector pU1391W used to study subcellular localization of proteins. RB and LB, right and left T-DNA border;; Hpt, hygromycin phosphotransferase gene; GFP, green fluorescent protein gene; P WRKY13, rice OsWRKY13 promoter; NOS, napoline synthase polyadenylation signal. RB P WRKY13 target gene GFP NOS Hpt LB HindIII PstI BamHI EcoRI

2 Figure S2. Gel mobility shift assays. The electrophoresis was performed with the gel plates of 6 cm in length, which could not clearly distinguish different sizes of DNA- protein complexes. The nuclear proteins were from 8 h after mock-inoculated (control) or JL691- inoculated Mudanjiang 8. DNA probes are 39- to 51-bp in length (Supplemental Table 2). (a) D53I8 D53I10D53I12D53I14 D53I16D53I18D53I20D53I22D53I24 Mock inoculation D53I8 D53I10D53I12D53I14 D53I16 D53I18 D53I20 D53I22D53I24 Pathogen (JL691) inoculation

3 D53I12-1 (pathogen inoculation)D53I12-2 (pathogen inoculation) D53I16-1 (pathogen inoculation) D53I16-2 (pathogen inoculation) To determine the pathogen-responsive DNA-protein binding regions in probes D53I12 and D53I16 as shown in Supplemental Fig. 2a, four 17- to 25-bp probes (Supplemental Table 2) from the two long probes were examined for their binding ability to nuclear proteins from pathogen-inoculated rice cultivar Mudanjiang 8. The gel mobility shift assay shows that D53I8-1, D53I12-1 do not contain protein- binding site and D53I12-2, D53I16-1 and D53I16-2 contain protein-binding sites. (b)

4 To further define the pathogen-responsive DNA-protein binding regions in probes D53I12-2 and D54I16-2 as shown in Supplemental Fig. 2b, four 9- to 13-bp probes (Supplementary Table 2) from the two long probes were examined for their binding ability to nuclear proteins from pathogen-inoculated rice cultivar Mudanjiang 8. The gel mobility shift assay shows that D53I12-2-1, D53I12-2-2 and D53I16-2-2 contain protein-binding sites and D53I16-2-1 do not contain protein-binding site. D53I12-2-1 (pathogen inoculation)D53I12-2-2 (pathogen inoculation)D53I16-2-1 (pathogen inoculation) D53I16-2-2 (pathogen inoculation) (c)

5 To further define the pathogen-responsive DNA-protein binding regions in probes D53I12-2-1and D53I16-2-2 as shown in Supplemental Fig. 2c, six 5- to 7-bp probes (Supplementary Table 2) from the two long probes were examined for their binding ability to nuclear proteins from pathogen-inoculated rice cultivar Mudanjiang 8. The gel mobility shift assays show that all the probes contain protein-binding sites, indicating that the protein-binding sites in the two probes shown in Supplemental Fig. 1C can not be further defined. (d) D53I12-2-1-1 (pathogen inoculation)D53I12-2-1-2 (pathogen inoculation)D53I12-2-1-3 (pathogen inoculation)D53I16-2-2-1 (pathogen inoculation)D53I16-2-2-2 (pathogen inoculation)D53I16-2-2-3 (pathogen inoculation)

6 (e) D53I16-2-2 (M) D53I12-2-1 (P) D53I16-2-2 (P) D53I12-2-1 (M) The nuclear proteins were from 8 h after mock-inoculated (M, control) or pathogen (JL691)-inoculated (P) Mudanjiang 8. The gel mobility shift assay shows that D53I12-2-1 and D53I16-2-2 contain protein-binding sites, which have the same protein binding patterns as D53I12 and D54I16 shown in Supplemental Fig. 2a.

Download ppt "Figure S1. Schematic diagram of vector pU1391W used to study subcellular localization of proteins. RB and LB, right and left T-DNA border;; Hpt, hygromycin."

Similar presentations

Suppl. Fig. S1 Suppl. Fig. S1 The nucleotide sequence and its deduced amino acid sequences of CaSAMDC. The full-length of CaSAMDC (GenBank Accession No.

Suppl. Fig. S1 Suppl. Fig. S1 The nucleotide sequence and its deduced amino acid sequences of CaSAMDC. The full-length of CaSAMDC (GenBank Accession No.
Lecture 18, Chapter 11 Analysis of transgenic plants part I Mat Halter 3/27/12 Plant Genetics, Breeding and Biotechnology (PLSC 452/552), University of.

Lecture 18, Chapter 11 Analysis of transgenic plants part I Mat Halter 3/27/12 Plant Genetics, Breeding and Biotechnology (PLSC 452/552), University of.
MCB 317 Genetics and Genomics MCB 317 Topic 10, part 1 A Story of Transcription.

MCB 317 Genetics and Genomics MCB 317 Topic 10, part 1 A Story of Transcription.
Making a Restriction Map

Making a Restriction Map
Analysis of Transgenic Plants. 1.Regeneration on Selective Medium Selectable Marker Gene.

Analysis of Transgenic Plants. 1.Regeneration on Selective Medium Selectable Marker Gene.
Chap. 7 Problem 1 In glucose media without lactose, the lac repressor is bound to the lac operator, and the CAP protein is not bound to its control site.

Chap. 7 Problem 1 In glucose media without lactose, the lac repressor is bound to the lac operator, and the CAP protein is not bound to its control site.
Figure S1: Ma et al., 2015 Supplementary Data 1: Southern blot of three individual plants per generation (T5, T6 and T7), following the digestion of genomic.

Figure S1: Ma et al., 2015 Supplementary Data 1: Southern blot of three individual plants per generation (T5, T6 and T7), following the digestion of genomic.
Lecture 7 Manipulation of foreign gene and secretion of foreign protein.

Lecture 7 Manipulation of foreign gene and secretion of foreign protein.
(A) RdRP 5‘UTR3‘UTR CP MP SP6 (B) (C) 3 dpi 15 dpi (D) Supplementary Figure 1 Infectivity analysis of Nicotiana tabacum. Schematic illustration of the.

(A) RdRP 5‘UTR3‘UTR CP MP SP6 (B) (C) 3 dpi 15 dpi (D) Supplementary Figure 1 Infectivity analysis of Nicotiana tabacum. Schematic illustration of the.
Supplementary Fig. S1 Determination of T-DNA copy number by Southern blot analysis. Fifteen µg genomic DNA of Bintje and mutant nikku were digested with.

Supplementary Fig. S1 Determination of T-DNA copy number by Southern blot analysis. Fifteen µg genomic DNA of Bintje and mutant nikku were digested with.
Www.le.ac.uk Analysis www.le.ac.uk/genie. Restriction enzyme mapping Plasmid one site / one cut Full length Plasmid Y X Z A + B = Full length B Plasmid.

Analysis Restriction enzyme mapping Plasmid one site / one cut Full length Plasmid Y X Z A + B = Full length B Plasmid.
Fig. 1.

Fig. 1.
A) EF175930 ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM208590.1 ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.

A) EF ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.
P Xa13 :GUSP xa13 :GUS Supplemental Figure 1  -glucuronidase (GUS) expression regulated by the promoters of dominant Xa13 (P Xa13 ) and recessive xa13.

P Xa13 :GUSP xa13 :GUS Supplemental Figure 1  -glucuronidase (GUS) expression regulated by the promoters of dominant Xa13 (P Xa13 ) and recessive xa13.
Supporting Fig. S1 OsRHR-GFP GFP ChlorophyllMerge GC Hoechst Merge GH Supporting Figure S1. The OsPHR-GFP fusion protein localizes to nuclei, chloroplasts,

Supporting Fig. S1 OsRHR-GFP GFP ChlorophyllMerge GC Hoechst Merge GH Supporting Figure S1. The OsPHR-GFP fusion protein localizes to nuclei, chloroplasts,
Leimgruber et al. Supplementary Figure 1 Supplementary Figure 1. The S’-Y’ and S-Y modules of the HLA-DRA gene exhibit lower levels of H4Ac, reduced nucleosome.

Leimgruber et al. Supplementary Figure 1 Supplementary Figure 1. The S’-Y’ and S-Y modules of the HLA-DRA gene exhibit lower levels of H4Ac, reduced nucleosome.
Fire-fly luciferase Light Signal transduction Signals luciferase luciferin Genetic Screens in Arabidopsis: Luciferase screening for gene discovery CCD.

Fire-fly luciferase Light Signal transduction Signals luciferase luciferin Genetic Screens in Arabidopsis: Luciferase screening for gene discovery CCD.
Part Two and Three The Applications of Gene Cloning and DNA Analysis in Research and Biotechnology Chapter 10. Studying gene location and structure Chapter.

Part Two and Three The Applications of Gene Cloning and DNA Analysis in Research and Biotechnology Chapter 10. Studying gene location and structure Chapter.
Cui-Cui Zhang, Wen-Ya Yuan, Qi-Fa Zhang  Molecular Plant 

Cui-Cui Zhang, Wen-Ya Yuan, Qi-Fa Zhang  Molecular Plant 
Table A. Sequences used in making CsKASII RNAi constructs

Table A. Sequences used in making CsKASII RNAi constructs

Similar presentations

Ads by Google