Presentation is loading. Please wait.

Presentation is loading. Please wait.

Fig. S1 Chlorophyll content of bypass transgenics. The chlorophyll content per leaf fresh weight was measured. Overall, bypass transgenics had comparable.

Published byHortense Owens Modified over 9 years ago

Similar presentations

Presentation on theme: "Fig. S1 Chlorophyll content of bypass transgenics. The chlorophyll content per leaf fresh weight was measured. Overall, bypass transgenics had comparable."— Presentation transcript:

1 Fig. S1 Chlorophyll content of bypass transgenics. The chlorophyll content per leaf fresh weight was measured. Overall, bypass transgenics had comparable amount of chlorophyll to WT per mg. leaf tissue. Fig. S2 Fv/Fm ratios of bypass transgenics. Chlorophyll fluorescence (Fv/Fm) was measured using LI6400-XT on dark-acclimated plants. Based on the ratios, the maximum efficiency of photosystem II was estimated to be comparable between bypass transgenics and WT.

2 Plant LineAmount of transgenic protein (µg/g) GlcDGlcEGlcFTSRGCL DEF2(60)1.5±0.40.6±0.11.1±0.1 DEF2(72)0.5±0.20.4±0.10.7±0.2 DEF2+TG1(51)0.6±0.31.3±0.20.5±0.12.3±0.64.6±1.2 DEF2+TG1(69)1.2±0.20.4±0.050.4±0.11.8±0.63.8±0.6 TG1(10)14.1±0.44±0.4 TG1(29)9.6±67.4±3.7 WT00002.4±0.7 Table S2 Leaf area of different transgenic lines (measured using ImageJ). Leaf area (cm 2 ) Controls (cm 2 )DEF2 line (cm 2 ) DEF2+TG1 line (cm 2 ) WT-5719.760-49113.551-50515.6 WT-5768.560-49718.651-50112.5 WT-57210.460-49210.951-50713.5 WT-57410.960-49313.551-49916.3 WT-58017.272-48215.769-51115.0 WT-58112.172-48513.669-50919.2 WT-58211.172-48615.969-51223.3 72-48716.569-51620.2 AVG control11.4 AVG DEF2 14.8 AVG DEF2+TG1 16.9 Table S1 The transgenic protein content in various lines was determined using peptide-specific antibodies by ELISA.

3 PlotSmear: DEF2 vs. WT Log fold change Log concentration PlotSmear: DEF2+TG1 vs. WT Log fold change Log concentration PlotSmear: DEF2 +TG1 vs. DEF2 Log fold change Log concentration Fig. S3 (a-c) plotSmear plots were generated using the edgeR package. A plotSmear plot is used to visualize the relationship between the contig count concentrations and fold change in a log scale. In the figure, red dots represent differentially expressed genes between the samples. The orange dots represent contigs with zero count values in some of the samples. The blue line represents biological significance at 2 log-FC. a c b

4 Primer sequences: mChXhoFP: 5’- TGGAGAAACTCGAGCTTGTCGATCGACCTTGTACAGCTCGTCCAT-3’ mChXhoRP: 5’- TAAAGCATGGTTCTCGAGCTTTCGCAGATATGGTGAGCAAGGGC-3’. RBCS-F1 5’-CCACTATGGTCGCTCCTTTC-3’ BCCP-F1 5’-TTCTCTCCAAGCCTAGTCGC-3’ GLCD-R2: 5’-CTGCAAGTCCAGCTTTTTCC-3’ GLCE-R2: 5’-AAGTTCCCTTGCAGCTTTCA-3’ GLCF-R2: 5’- TCCTTAACGAATGCACCACA-3’ GCL-R2:5’- GAAACAGGCTTTGCGATAGC-3’ TSR-R2: 5’- TTTTCCGAGGAGTTCGAAGA-3’ SVP1 FP 5’- CGCCCGAATGAGTAAAGAAA -3’ SVP1 RP 5’- ACCGCTTGTTCTCATCCATC -3’ For RNA-seq validation comp87597_c0_seq1 (Chloroplastic acetylcoenzyme a carboxylase 1) F 5’-GATGCCGATGACA A ACA AGA-3’ R 5’-TGTCAGA A AGCCACA A ACACA-3’ comp105151_c0_seq8 (Thioredoxin superfamily protein) F 5’- ACAAGAGTGGTCGGGAGATA-3’ R 5’- GGTCTGTACCGTTTGGTAGTG-3’ comp102484_c0_seq2 (Cytidine deoxycytidylate deaminase family protein) F 5’-CAACCATCCCAATCACAACTCT -3’ R 5’-TCCTCGATCAATCCACGAACT -3’ comp108897_c0_seq7 (mitochondrial import inner membrane translocase subunit tim17 tim22 tim23 family protein) F 5’-GCCATCCTTGAACTGCTTCTC -3’ R 5’-CTCCGTGAGCTTCTCTTCACTA -3’ comp91143_c0_seq1 (AT3G28918 very small protein coding gene with unknown function) F 5’- TGCTCTTTCGAGTTTGAGTT-3’ R 5’- AAAGAGGGAAGCTAAAGCC-3’ comp99717_c0_seq4 (Cytochrome b-c1 subunit 8 protein) F 5’-GTCTCGTACTCGTACTGTGGAA -3’ R 5’- CGCAAGCCTAGTGTTTGTAGTT-3’ comp108897_c0_seq4 (Putative Protein ) F 5’- GGTGCATCCTTAGTGAAGAGAA-3’ R 5’- AAGTTCGGAACGAGGCTAAC-3’ Antigen sequences: GlcD ERLDGALPDVDRTSC GlcE GLAGPRRPWSGSVRC GlcF CLPAETVKAKPRPPL GCL CRHTGSVEKYTEGRK TSR CAPVSGGEIGAREGT Table S3. Primer and antigen sequences

Download ppt "Fig. S1 Chlorophyll content of bypass transgenics. The chlorophyll content per leaf fresh weight was measured. Overall, bypass transgenics had comparable."

Similar presentations

Photosynthesis. Photosynthesis - overview 1. The conversion of light energy (from the sun) into chemical energy (stored in sugar & organic molecules.

Photosynthesis. Photosynthesis - overview 1. The conversion of light energy (from the sun) into chemical energy (stored in sugar & organic molecules.
Sugar Content Analysis

Sugar Content Analysis
Figure 1. Live/Dead assay of cells in High Insulin+Col II bead shows high mortality. The above figure shows the Live/Dead assay taken of cells in an example.

Figure 1. Live/Dead assay of cells in High Insulin+Col II bead shows high mortality. The above figure shows the Live/Dead assay taken of cells in an example.
Suppl. Fig. S1 Suppl. Fig. S1 The nucleotide sequence and its deduced amino acid sequences of CaSAMDC. The full-length of CaSAMDC (GenBank Accession No.

Suppl. Fig. S1 Suppl. Fig. S1 The nucleotide sequence and its deduced amino acid sequences of CaSAMDC. The full-length of CaSAMDC (GenBank Accession No.
Title: Stress-inducible expression of barley Hva1 gene in transgenic mulberry displays enhanced tolerance against drought, salinity and cold stress Journal.

Title: Stress-inducible expression of barley Hva1 gene in transgenic mulberry displays enhanced tolerance against drought, salinity and cold stress Journal.
Pollen transcript unigene identifier log 2 -fold change Annotation (BLAST) Unigene7226-11.1 L. longiflorum chloroplast, complete genome Unigene24307-10.1.

Pollen transcript unigene identifier log 2 -fold change Annotation (BLAST) Unigene L. longiflorum chloroplast, complete genome Unigene
Figure S1_Yao Qin et al. Figure S1 Occurrence and distribution of trihelix family in different plant species. Red branches in the cladogram indicate that.

Figure S1_Yao Qin et al. Figure S1 Occurrence and distribution of trihelix family in different plant species. Red branches in the cladogram indicate that.
Important structures in a leaf Two structures important for photosynthesis: Stoma (pl. Stomata): Pores in a plant’s cuticle through which water and.

Important structures in a leaf Two structures important for photosynthesis: Stoma (pl. Stomata): Pores in a plant’s cuticle through which water and.
Supplementary Fig. S1: Hierarchical clustering of AUX/IAA genes, showing significant differential expression under at least one abiotic stress condition.

Supplementary Fig. S1: Hierarchical clustering of AUX/IAA genes, showing significant differential expression under at least one abiotic stress condition.
Conclusions From the data gathered, it is concluded that Mn deficiency depresses the leaf photosynthetic capacity primarily by reducing the number of PS.

Conclusions From the data gathered, it is concluded that Mn deficiency depresses the leaf photosynthetic capacity primarily by reducing the number of PS.
Top X interactions of PIN Network A interactions Coverage of Network A Figure S1 - Network A interactions are distributed evenly across the top 60,000.

Top X interactions of PIN Network A interactions Coverage of Network A Figure S1 - Network A interactions are distributed evenly across the top 60,000.
Figure S1 Enod11 Mtc27 MtGshs cDNA gDNA S. meliloti DPI --++ - + + - Supporting Information Fig. S1. Validation of the selected biological conditions for.

Figure S1 Enod11 Mtc27 MtGshs cDNA gDNA S. meliloti DPI Supporting Information Fig. S1. Validation of the selected biological conditions for.
(3408983) 2.2 FC autism control FGR1OP2. (3806939) 1.4 FC autism control SMAD2.

( ) 2.2 FC autism control FGR1OP2. ( ) 1.4 FC autism control SMAD2.
Supplementary materials

Supplementary materials
Pcfs4-1PCFS4-TAP Figure S1 Figure S1. Expression of PCFS4-TAP fusion protein in transgenic plants. The total protein extracts from the mutant (pcfs4-1)

Pcfs4-1PCFS4-TAP Figure S1 Figure S1. Expression of PCFS4-TAP fusion protein in transgenic plants. The total protein extracts from the mutant (pcfs4-1)
Supporting Fig. S1 OsRHR-GFP GFP ChlorophyllMerge GC Hoechst Merge GH Supporting Figure S1. The OsPHR-GFP fusion protein localizes to nuclei, chloroplasts,

Supporting Fig. S1 OsRHR-GFP GFP ChlorophyllMerge GC Hoechst Merge GH Supporting Figure S1. The OsPHR-GFP fusion protein localizes to nuclei, chloroplasts,
Within Strain ANOVA WTdHAP4 p < 0.052377 (38.4%)2387 (38.6%) p < 0.011531 (24.7%)1489 (24.1 %) p < 0.001850 (13.8%)679 (11.0%) p < 0.0001449 (7.25%)240.

Within Strain ANOVA WTdHAP4 p < (38.4%)2387 (38.6%) p < (24.7%)1489 (24.1 %) p < (13.8%)679 (11.0%) p < (7.25%)240.
SUPPORTING INFORMATION Figure S1. Cotton whitefly infestation within a sealed chamber.

SUPPORTING INFORMATION Figure S1. Cotton whitefly infestation within a sealed chamber.
Figure S1. Co-expression network for MNM1: Shown is the co-expression network obtained from the ATTED-II database using MNM1 as a bait gene. The red dots.

Figure S1. Co-expression network for MNM1: Shown is the co-expression network obtained from the ATTED-II database using MNM1 as a bait gene. The red dots.
Supporting information Figures S1-S5. % Supplemental figure 1 Figure S1: Mycorrhizal colonization parameter et al 1996 Mycorrhizal colonization parameters.

Supporting information Figures S1-S5. % Supplemental figure 1 Figure S1: Mycorrhizal colonization parameter et al 1996 Mycorrhizal colonization parameters.

Similar presentations

Ads by Google