1. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero Chapter 20 DNA Technology and Genomics

2. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings DNA technology DNA technology – methods for studying and manipulating genetic material.

3. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Manipulating Genomes Recombinant DNA- combining nucleotide sequences from 2 different sources Genetic engineering – manipulating genes Biotechnology – manipulating organisms

4. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Examples of DNA technology and manipulating genomes – Human genome project Map all the human DNA down to its nucleotide sequences – DNA fingerprinting – Cancer research, gene therapy – Agricultural fields (better crops)

5. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Cloning Gene cloning - production of multiple identical copies of a specific gene or other DNA segment Recombinant DNA technology allowed scientists to take the first step towards cloning.

6. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings DNA Cloning and Its Applications: A Preview Most methods for cloning pieces of DNA in the laboratory – Share certain general features 1. use bacteria 2. use plasmids Plasmids – small, circular DNA molecules – Replicate separately from the nucleoid – They are helpful because they can carry virtually any gene and replicate in bacteria.

7. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Overview of gene cloning 1.Plasmid is isolated from bacteria 2. Gene of interest is obtained from another cell. EX. Plant gene carrying resistance to pests. 3.Piece of that gene is inserted into the plasmid Now recombinant DNA 4. Bacterial cell takes up the plasmid through transformation 5. Cell multiplies with gene of interest Uses with gene Pest resistance Oil eating bacteria Uses with protein Human growth hormone Dissolve blood clots Cloned genes

8. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Using Restriction Enzymes to Make Recombinant DNA Bacterial restriction enzymes – Cut DNA molecules at a limited number of specific DNA sequences, called restriction sites – Like “cutting” and “pasting”

9. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Restriction enzymes Restriction enzymes are the cutting tool. – There are hundreds of restriction enzymes – They chop up the foreign DNA Each restriction enzyme recognizes a specific DNA sequence or restriction site (usually four to eight nucleotides long) – Yielding a set of restriction fragments These fragments have “sticky ends” that can bond with complementary “sticky ends” of other fragments DNA ligase is an enzyme – That seals the bonds between restriction fragments

10. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Figure 20.3 Restriction site DNA 5 3 5 3 G A A T T C C T T A A G Sticky end Fragment from different DNA molecule cut by the same restriction enzyme One possible combination Recombinant DNA molecule G C T T A A A A T T C G C T T A A G G G G A A T TCA A T T C C T T A A G C T T A A G Using a restriction enzyme and DNA ligase to make recombinant DNA Restriction enzyme cuts the sugar-phosphate backbones at each arrow 1 DNA fragment from another source is added. Base pairing of sticky ends produces various combinations. 2 DNA ligase seals the strands. 3

11. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Cloning a Eukraryotic Gene in a Bacterial Plasmid In gene cloning, the original plasmid is called a cloning vector – Defined as a DNA molecule that can carry foreign DNA into a cell and replicate there

12. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings

13. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Storing Cloned Genes in Libraries In the above example, no single gene is targeted for cloning. In step 3 there can be thousands of different recombinant plasmids These plasmid-containing cell clones are referred to as a genomic library. – Certain bacteriophages have also been used as cloning vectors for making genomic libraries.

14. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Nucleic acid probes for finding the genes of interest In gene cloning it can be difficult to identify the colony carrying the specific DNA fragment of interest. – Back in step 4, all the white colonies would be a bacteria with recombinant DNA – To find a gene of interest it can be based paired with a complementary sequence on another nucleic acid molecule. Nucleic acid hybridization is one way to obtain a specific gene of interest

15. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Nucliec Acid probes If we know that our hypothetical gene contains the sequence TAGGCT, a biochemist can use nucleotides labeled with a radioactive isotope to synthesize a strand of DNA with ATCCGA – This short strand (ATCCGA) is called the nucleic acid probe

16. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Amplifying DNA in Vitro: The Polymerase Chain Reaction (PCR) The polymerase chain reaction, PCR – Used if the source of DNA is scanty or impure – Can produce many copies of a specific target segment of DNA in a test tube.

17. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings The PCR procedure Figure 20.7 Target sequence 5 3 5 Genomic DNA Cycle 1 yields 2 molecules Cycle 2 yields 4 molecules Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence 5 3 3 5 Primers New nucleo- tides 3 APPLICATION With PCR, any specific segment—the target sequence—within a DNA sample can be copied many times (amplified) completely in vitro. TECHNIQUE The starting materials for PCR are double- stranded DNA containing the target nucleotide sequence to be copied, a heat-resistant DNA polymerase, all four nucleotides, and two short, single-stranded DNA molecules that serve as primers. One primer is complementary to one strand at one end of the target sequence; the second is complementary to the other strand at the other end of the sequence. RESULTS During each PCR cycle, the target DNA sequence is doubled. By the end of the third cycle, one-fourth of the molecules correspond exactly to the target sequence, with both strands of the correct length (see white boxes above). After 20 or so cycles, the target sequence molecules outnumber all others by a billionfold or more. Denaturation: Heat briefly to separate DNA strands 1 Annealing: Cool to allow primers to hydrogen-bond. 2 Extension: DNA polymerase adds nucleotides to the 3 end of each primer 3 DNA polymerase added. This is the DNA replication enzyme

18. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings mRNA can also be used as the starting material. – A researcher would isolate mRNA and make single- stranded DNA transcripts from it using reverse transcriptase (obtained from retroviruses) – Enzymes are added to break down the mRNA, and DNA polymerase is used to synthesize a second strand of DNA This DNA is called cDNA or complementary DNA Useful for studying specialized functions its smaller, has no introns.

19. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings DNA sequencing the process of determining the exact sequence of nucleotides in a stretch of DNA – Used to take a very long time to determine an exact sequence – Today it is automated Use restriction enzymes to cut long pieces of DNA into discrete fragments These fragments are then analyzed by machines.

20. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Gel Electrophoresis Gel electrophoresis – helps to sort DNA molecules – Separates DNA restriction fragments of different lengths Figure 20.8 APPLICATION 1 Each sample, a mixture of DNA molecules, is placed in a separate well near one end of a thin slab of gel. The gel is supported by glass plates, bathed in an aqueous solution, and has electrodes attached to each end. 2 When the current is turned on, the negatively charged DNA molecules move toward the positive electrode, with shorter molecules moving faster than longer ones. Bands are shown here in blue, but on an actual gel, DNA bands are not visible until a DNA-binding dye is added. The shortest molecules, having traveled farthest, end up in bands at the bottom of the gel. Cathode Power source Gel Glass plates Anode Mixture of DNA molecules of differ- ent sizes Longer molecules Shorter molecules TECHNIQUE RESULTS After the current is turned off, a DNA-binding dye is added. This dye fluoresces pink in ultraviolet light, revealing the separated bands to which it binds. In this actual gel, the pink bands correspond to DNA fragments of different lengths separated by electrophoresis. If all the samples were initially cut with the same restriction enzyme, then the different band patterns indicate that they came from different sources. Gel electrophoresis is used for separating nucleic acids or proteins that differ in size, electrical charge, or other physical properties. DNA molecules are separated by gel electrophoresis in restriction fragment analysis of both cloned genes (see Figure 20.9) and genomic DNA (see Figure 20.10). Gel electrophoresis separates macromolecules on the basis of their rate of movement through a gel in an electric field. How far a DNA molecule travels while the current is on is inversely proportional to its length. A mixture of DNA molecules, usually fragments produced by restriction enzyme digestion, is separated into “bands”; each band contains thousands of molecules of the same length.

21. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Comparing DNA sequences Each persons’ DNA is different Restriction fragments (pieces of DNA) are used to make comparisons – The number of restriction fragments and their sizes reflect the specific sequence of nucleotides in your DNA

22. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Concept 20.3: Entire genomes can be mapped at the DNA level The Human Genome Project – Sequenced the human genome Scientists have also sequenced genomes of other organisms – Providing important insights of general biological significance

23. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings The strategy of The Human Genome Project The public consortium followed a hierarchy of three stages 1.Linkage mapping 2. physical mapping 3. DNA sequencing then assembly of the overall sequence An alternative approach to sequencing whole genomes starts with the sequencing of random DNA fragments – Powerful computer programs would then assemble the resulting very large number of overlapping short sequences into a single continuous sequence

24. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings The strategy continued The Celera whole-genome shotgun approach omitted the first two stages 2 3 4 Sequence each fragment ACGATACTGGT CGCCATCAGTACGATACTGGT AGTCCGCTATACGA …ATCGCCATCAGTCCGCTATACGATACTGGTCAA… Figure 20.13 Each chromosome was cut into small fragments These were cloned in plasmid or phage vectors Powerful computers assembled the overlapping fragments to determine the overall sequence.

25. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Concept 20.4: Genome sequences provide clues to important biological questions In genomics – Scientists study whole sets of genes and their interactions

26. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Identifying Protein-Coding Genes in DNA Sequences Computer analysis of genome sequences – Helps researchers identify sequences that are likely to encode proteins

27. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Current estimates are that the human genome contains about 25,000 genes – But the number of human proteins is much larger Table 20.1

28. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Comparison of the sequences of “new” genes – With those of known genes in other species may help identify new genes –.

29. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Determining Gene Function For a gene of unknown function – Experimental inactivation of the gene and observation of the resulting phenotypic effects can provide clues to its function

30. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Comparing Genomes of Different Species Comparative studies of genomes from related and widely divergent species – Are providing valuable information in many fields of biology – The functions of some human genes have been identified through the study of similar yeast genes

31. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Future Directions in Genomics Genomics – Is the study of entire genomes Proteomics – Is the systematic study of all the proteins encoded by a genome How do the “parts” work in the whole system? Knowing how proteins interact will help scientists understand how cells and organisms function.

32. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Concept 20.5: The practical applications of DNA technology affect our lives in many ways Numerous fields are benefiting from DNA technology and genetic engineering

33. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Medical Applications One obvious benefit of DNA technology – Is the identification of human genes whose mutation plays a role in genetic diseases

34. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Diagnosis of Diseases Medical scientists can now diagnose hundreds of human genetic disorders – By using PCR and primers corresponding to cloned disease genes, then sequencing the amplified product to look for the disease- causing mutation

35. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Human Gene Therapy Gene therapy – Is the alteration of an afflicted individual’s genes – Holds great potential for treating disorders traceable to a single defective gene – Uses various vectors for delivery of genes into cells

36. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Figure 20.16 Bone marrow cell from patient Retrovirus capsid Viral RNA Cloned gene (normal allele, absent from patient’s cells) 2 Gene therapy using a retroviral vector Insert RNA version of normal allele into retrovirus. 1 Let retrovirus infect bone marrow cells that have been removed from the patient and cultured. 2 Viral DNA carrying the normal allele inserts into chromosome. 3 Inject engineered cells into patient. 4

37. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Practical problems? – Proper control mechanisms are present so that the gene is expressed at the proper time, in the proper place, and to the proper degree. – Insertion of the therapeutic gene must not harm other cell functions. Ethical considerations? – Should it be done on germ cells (cells that become egg and sperm) thus influencing the genetic makeup of future generations.

38. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Pharmaceutical Products Applications of DNA technology include – Large-scale production of human hormones and other proteins with therapeutic uses – Production of safer vaccines

39. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Forensic Evidence DNA “fingerprints” obtained by analysis of tissue or body fluids found at crime scenes – Can provide definitive evidence that a suspect is guilty or not

40. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings A DNA fingerprint – Is a specific pattern of bands of RFLP markers on a gel Defendant’s blood (D) Blood from defendant’s clothes Victim’s blood (V) D Jeans shirt V 4  g 8  g Figure 20.17

41. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings DNA fingerprinting – Can also be used in establishing paternity

42. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Environmental Cleanup Genetic engineering can be used to modify the metabolism of microorganisms – So that they can be used to extract minerals from the environment or degrade various types of potentially toxic waste materials

43. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Agricultural Applications DNA technology – Is being used to improve agricultural productivity and food quality

44. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Animal Husbandry and “Pharm” Animals Transgenic animals – Contain genes from other organisms

45. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings – Have been engineered to be pharmaceutical “factories” Figure 20.18

46. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Genetic Engineering in Plants Agricultural scientists – Have already endowed a number of crop plants with genes for desirable traits

47. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Safety and Ethical Questions Raised by DNA Technology The potential benefits of genetic engineering – Must be carefully weighed against the potential hazards of creating products or developing procedures that are harmful to humans or the environment

48. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Today, most public concern about possible hazards – Centers on genetically modified (GM) organisms used as food