1. 1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT GCAAGCCTCAATGGATCCACCACCCTTTTTGG TGCAAGCCTCAATGGATCCACCACCCTTTTTG GTGCAGCCTCAATGGATCCACCACCCTTTTTG GGCAGCCTCAATGGATCCACCACCCTTTTTG GTGCAAGCCTCAATGGATCCACCACCCTTTTT GGTGCAAGCCTCAATGGATCCACCTCCACCA CCCTTTTTGGTGCATGTGCCATGGC

2. 2

3. 3 u Gene expression u Transcription u Translation u Functional proteins: post-translational modifications u Phosphorylation u Glycosylation u Sorting: targeting to appropriate organelles u Modulation by extracellular signals u Covalent modification u Association with other molecules u Degradation

4. 4 Sorting and Secretory pathways u diverged in trans-Golgi u Constitutive pathway u many soluble proteins u Regulated pathway u stored in secretory vesicles u active transport from cytosol to vesicles u complexed with macromolecules (e.g. proteglycans)

5. 5 Regulated secretory pathway u In response to extracellular stimuli: hormone, transmitters, digestive enzymes u stored in secretory vesicles u active transport from cytosol to vesicles u complexed with macromolecules (e.g. proteglycans) to reach high concentration

6. 6

7. 7 Three pathways in Golgi u to lysosome u with mannose-6-phosphate, via late endosome to lysosome u to secretory pathways u Constitutive: to apical or basolateral domain u Regulated

8. 8

9. 9 “Roadmap” for traffic u Transport u Gated transport: cytosol and nucleus via nuclear pore complexes u Membrane transport: via membrane-bound translocators; unfolded u Vesicle transport: vesicles u Sorting signals

10. 10 Membrane transport u Membrane-bound translocators u Unfolding of protein to be transported u Passing through a topologically distinct space: cytosol to ER; cytosol to mitochondria

11. 11 Equivalent space for transport u Cycles of budding and fusion permits transport of molecules

12. 12 Sorting signals u Signal sequences u 15-60 aa u Removed by signal peptidase when reaching the target u Signal patch u Usually non-continuous stretch of sequences u Exposed when appropriately folded

13. 13 Sorting signals

14. 14 Signal sequences u Function: specify the direction for destination u for initial transfer to the ER: with a signal sequence at N-terminus; consisting of 5-10 hydrophobic aa u Go forward Golgi: most proteins u Return to ER (ER residents): with a specific sequence of 4 aa at C-terminus u Go to mitochondria: positively charged amino acids alternate with hydrophobic ones u Go to peroxisome: with a signal peptide of 3 characteristic at C terminus

15. 15 Signal sequences

16. 16 Experiments to demonstrate “zip code” u Swap the signal sequence: u e.g.: adding the ER signal sequences to a cytosolic protein results in the retention of this protein in ER u Hyprophobicilty: maybe a determing factor of signal sequences

17. 17 G ü nter Blobel

18. 18 Effect of misdirected protein

19. 19

20. 20 Overview of protein sorting

21. 21 Protein sorting u ER u ER-Golgi intermediate u Glogi network

22. 22 Glycosylation in ER

23. 23 Lysosomal protein: phosphorylation of mannose

24. 24 Sorting in Golgi u Export u Lysosome u Secretion u Constitute u Regulated u Retain in Golgi u transmembrane

25. 25 Transport to plasma membrane u TGN u Apical domain u Basolateral domain

26. 26 Endocytosis u Phagocytosis (cell eating) u Ingestion of large particles (e.g. bacteria) u In specialized cells u Pinocytosis (cell drinking) u Up-take of fluids or macromolecules in small vesicles u Receptor-mediated endocytosis u Common among eukaryotic cells

27. 27 Phagocytosis u Pseudopodia u Phagosome u Phagolysosome

28. 28 Receptor-mediated endocytosis u Clathrin-coated pits u Clathrin-coated vesicles u Example: cholesterol, LDL, LDL receptor

29. 29 LDL: low density lipoprotein u Core u ~1500 Cholesterol ester u Coat u ~500 cholesterol u ~ 800 phospholipid u 1 Apoprotein B100

30. 30 LDL receptor u MS Brown, JL Goldstein u Familial hypercholesterolemia u LDL-binding domain u Internalization signal

31. 31 LDL receptor u Internalization signal: Tyr

32. 32 Clathrin-coated pits

33. 33 Lysosomal proteins in clathrin-coated pits

34. 34 Sorting in early endosome u Acidic ph by H + pump for dissociation of proteins

35. 35 Recycling of synaptic vesicles

36. 36 Protein sorting by transcytosis u Membrane protein in apical domain u Secretory proteins from bloodstream

37. 37 Lysosomal system u For membrane-bound proteins and proteins taken by endocytosis u Multiple acid proteases (cathepsins) and other hydrolases u Studied with weak bases to inhibit lysosomal acidification or lysosomal inhibitors (E64)