1. E. Coli Fluorescing Red Using Cold Temperature Sensor Prm + I12007. B0032 Team: E Cool I Tina Khoury Jeremy Gerbig Kerwin Dunham Derek Blanchard

2. Goals  Achieve E. coli to fluoresce red at low temp (37°C) in presence of Cl or Cl (ts).  Find optimum temp where color change will be found.  ~ 30-37°C  Find optimum concentration of Cl. Gene originally from coral.  Backup Plan Use high temp parts to make E. coli fluoresce at high temp instead at low using a different gene. Expressing high (green) and low (red) temp. genes in one sequence.

3. How to do it?  Part 1 BBa_I12007  82Bp  Promoter: modified lambda Prm Promoter  (OR-3 obliterated)  2010 Kit Plate 2 Box 5 Well 11L, pSB2K3  gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagata tttataaatagtggtgatagatttaacgt

4.  Part 2 & 3 Super Part BBa_I13503 Spring 2008 Distribution Source Plate 1002 1D pSB1A2Source Plate 1002 BBa_B0032  13Bp  Ribosome Binding Site RSB.3  (medium)- derivative of BBa_0030  2010 Kit Plate 1 Well 2I, pSB1A2  tcacacaggaaag

5.  Part 2 & 3 Super Part BBa_I13503 Spring 2008 Distribution Source Plate 1002 1D pSB1A2Source Plate 1002 3 BBa_E1010  681Bp  Gene: highly engineered mutant of red fluorescent protein from Discosoma striata (coral)  2010 Kit Plate 1 Well 18F, pSB2K3  atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaac ggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaa actgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacg gttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggt ttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctg caagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttat gcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctga aaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaacc acctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatca cctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccgg tgcttaataa

6.  Part 4 & 5 Super Part BBa_B0015 BBa_B0010 doubleT  129 Bp  Stop, T1 from E. coli rrn B  (Transcriptional Terminator)  2010 Kit Plate 1 Well 13D, pSB1A2 BBa_B0012  Stop, TE from coliophage T7  (Transcriptional Terminator)  Source Plate 1000 Well 1B, pSB1A2  ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctt tcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactg gctcaccttcgggtgggcctttctgcgtttata

7. What’s new?  The complete complex Biobricks sequence that works! Combine 3 parts  BBa_I12007 - Promoter  BBa_I13503 - RBS + Gene  BBa_B0015 - Double Terminator PromoterRBS + GeneDouble Terminator

8. Protocol  Isolate biobricks out of wells.  BBa_I12007 - Promoter  BBa_I13503 - RBS + Gene  BBa_B0015 - Double Terminator  Transform the bacteria.  Grow the transformed bacteria.  Isolate & check plasmids. Gel Electrophoresis

9. Protocol cont…  Combining biobrick parts by digestion & ligation. BBa_I12007 - PromoterBBa_I13503 - RBS + Gene BBa_B0015 - Double Terminator SX & P

10. Protocol cont….  Transform bacteria with new recombinant plasmid.  Observe results Color change dependent on  Temp between ~ 30-37°C  Cl concentration ~ 1x – 10x

11. References  Openwetware.org  Partsregistry.org  http://filebox.vt.edu/.../biol_4684/Methods/gene s.html  http://www.fasebj.org/content/vol20/issue14/im ages/large/z386120661480003.jpeg  http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?b ook=mga&part=A1549  http://www.stat.berkeley.edu/users/terry/Classes /s260.1998/Week8b/week8b/node3.html