3. Oswald Avery Canadian biologist (1877- 1955) Discovered DNA in 1944 with a team of scientists.

4. Hershey and Chase 1952 Attempted to solve the debate on whether DNA or proteins are responsible for providing the genetic material.

5. They used a bacteriophage (a virus which attacks bacteria) to prove that DNA was definitely the genetic material.

7. Phoebus A. Levene Russian born; immigrated to America, moves to Europe. 1920’s discovered nucleotides (building blocks of DNA) 1. Sugar 2. Phosphate group 3. Nitrogenous base

8. Chargaff’s rules The relative amounts of adenine and thymine are the same in DNA The relative amounts of cytosine and guanine are the same. Named after Erwin Chargaff

9. Rosalind Franklin Used X-Ray diffraction to get information about the structure of DNA:

10. Structure of DNA Discovered in 1953 by two scientists: James Watson (USA) Francis Crick (GBR) Known as the double-helix model.

11. The double-helix A twisted ladder with two long chains of alternating phosphates and sugars. The nitrogenous bases act as the “rungs” joining the two strands.

12. How long is the DNA molecule?

13. Chromosomes & DNA replication The nucleus of one human cell contains approximately 1 meter of DNA. Histones = DNA tightly wrapped around a protein Nucleosome:

14. RNA Very similar to DNA. Exceptions: 1) Ribose is the 5-carbon sugar 2) Uracil replaces thymine 3) Single-stranded

15. mRNA (messenger) Copies genetic code of DNA by matching bases. Occurs in the nucleus. DNA changing to RNA

16. Practice On your paper, complete the missing DNA strand by adding the complementary bases. A T C G T T G C C A T C T A G C A A C G G T A G Make the complementary RNA strand for the single strand of DNA below: A A T C A T C A C G T T U U A G U A G U G C A A

17. TRANSCRIPTION DNA is copied into mRNA with the aid of RNA polymerase. The RNA polymerase will bind to promoters that act as signals in the DNA sequence to make RNA.

18. Transcription continued:

19. Confusing genetic terms: Polypeptide = a chain of amino acids. Protein = a complex structure composed of polypeptides Amino acids = smallest structural unit of a polypeptide. Gene = a distinct unit of material found on a chromosome

20. Reading the genetic code The genetic code is responsible for building all the proteins in the body using 20 different amino acids. How many 3 letter words can you make from the letters A,T,G and C? Answer: 64

21. Codons A three letter “word” that specifies an amino acid.

22. tRNA (transfer) approx. 80 nucleotides in length. Cross-like shape At one end an amino acid is attached At the other end there is an anticodon Acts like a truck

23. Polypeptide assembly Translation = reading or “translating” the RNA code to form a chain of amino acids. Known as protein synthesis Occurs in the cytoplasm. (p.304)

24. Mutations The source of variation in a genetic sequence. Can be either gene or chromosomal mutations. Point mutations = a change in a single nucleotide in a sequence of DNA.

25. Frameshift Mutation Inserting an extra nucleotide which, in turn, shifts the entire sequence one way or the other.

26. Chromosomal mutations Involves a change in the number or structure of the chromosomes. Deletion : when a piece of a chromosome breaks off and is lost. Duplication : when a segment of a chromosome is repeated Inversion : when a segment of a chromosome is reversed.

27. More chromosomal mutations Translocation : when part of a chromosome breaks off and is attached to a non- homologous chromosome.

28. Control of gene expression Genes are often like light switches that can be turned off and on. Operon = occur in prokaryotes. (bacteria) different genes that work together to activate gene functions

29. Eukaryotic gene expression Controlled by complex sequences of DNA. Example: “TATA box”

30. Factors: Overall gene control is more difficult for eukaryotes because functional genes may be on different chromosomes. Environmental such as chemicals and temperature.

31. Hox and Oncogenes Hox genes Genes that actively control embryonic development. Oncogenes Genes known to cause cancer. Usually these are switched “off”, but can be switched “on” by a number of factors.

32. Assignment: Pages 315-116 1-10, 13, 15, 19, 20, 23 Transcribe this DNA sequence into RNA, then translate the RNA into an amino acid chain: TAGCCGACAGGCCTCTTTACT 1-12 page 317