1. Supplement to Figure 1 Cloning steps involved in the construction of the bidirectional T-DNA/Ds gene traps. A KpnI fragment from pSK200 (Kumar and Narayanan, 1997) containing sgfpS65T-nosT-Ds3’-GPA1-I-uidA- nosT-bla-ori was self-ligated to produce plasmid pHTTT1. A SacII-ScaI fragment from pCAMBIA1300 (http://www.cambia.org/main/r_et_camvec.htm ) containing the T-DNA LB was ligated with a SacI (end-filled), SacII digested pHTTT1 fragment to produce pHTTT2n2. An EcoRI fragment from pHTTT1 (nosT-sgfpS65T-bla- ori-nosT) was self-ligated to produce pHTTT3n that was in turn digested with HindIII and NcoI and ligated with an end-filled SacI-NcoI fragment from pHTTT1 (Ds3’-sgfpS65T-nosT) to produce pHTTT4n. A SalI fragment from pHTTT4n (Ds3’-GPA1-I-sgfpS65T-nosT) was cloned into pBlueScript II KS(-) to produce pHTTT4n_spacer. KpnI-SacII fragments from pHTTT2n2 (bla-ori-nosT-uidA-GPA1-I-Ds3’-LB) and pCAMBIA1300 (RB-VB) were ligated to produce pHTTT50N. A HindIII-KpnI fragment from pHTTT4n_spacer containing Ds3’-GPA1-I- sgfpS65T-nosT was then ligated to a similarly digested fragment from pHTTT5ON (RB-VB-LB-Ds3’-uidA-nosT- ori-bla) to produce pHTTT6ON. A XhoI-PstI fragment from pHTTT6ON carrying bla-ori-nosT was replaced with a compatible XhoI-PstI insert (bla-ori-nosT) from pACT_cass (Z. Li, unpublished) to produce pEU307, which housed the fully functional E. coli origin of replication within the T-DNA borders. The 378 bp end region of Ds5’ was amplified by PCR from pSK200 using the primer combination BamDs53 (5’ – GCCGGATCCGGCGTGTGAATGTGTGATG – 3’) and HindDs55 (5’ – GTCAAGCTTGACTAAAACAGGGATGAAAGTAGGATGGG – 3’). The PCR product was then digested with BamHI and HindIII and ligated to a compatible fragment (hph-sgfpS65T-nosT-bla-ori) from pMNK1007 (Upadhyaya et al., 1998), to produce pEU308d. A NcoI fragment (sgfpS65T-nosT-bla-ori-nosT-uidA) from pHTTT60N was self ligated and digested with XhoI and PstI to remove the existing bla-ori-nosT with the functional E. coli ori from pACT_cass to produce pEU309. A complete BamHI and partial NcoI digest was used to remove the existing hph chimeric gene from pEU308d which was replaced with a Sau3AI-NcoI fragment (GPA1_I) from pHTTT6ON to produce pEU313d. A BamHI site before the start codon, a PstI site 43 nucleotides downstream of ATG and a SacI site immediately after the stop codon of the Barnase coding region were introduced by PCR amplification of pMT416 (Hartley, 1988), with primers BamBN5 (5’ – ATGGATCCATGGTACCGGTTATCAACACGTTTGACGGGGTTGCGGATTATCTGCAGACATATCATAA G – 3’) and SacBN3 (5’ – AACGAGCTCGTTATCTGATTTTTGTAAAGG – 3’). The resultant PCR product was then digested with BamHI and SacI and cloned into pGEM ® -7Zf(-) to produce pEU319. A PstI fragment comprising the first intron of the castor bean catalase gene from pWJKK_IN2 (Wang, M.-B., unpublished) was inserted at the newly introduced PstI site in the 5’ region of Barnase gene in pEU319 to produce pEU320a. To re- introduce a segment of Ds5’ lost due to an internal BamHI site following restriction endonuclease digestion, the Ds5’ PCR product was amplified from pSK200 using primers BamDs53 and HindDs55 and then partially digested with BamHI and fully with HindIII and ligated to an appropriately digested pMNK1007 vector fragment to produce pEU321 and the small BamHI fragment from pEU321 was then ligated with BamHI digested pEU313d in the required orientation to produce pEU327a. A DrdI-SalI fragment from pWBVec8 (Wang et al., 1998) containing the aadA (Spec R ) gene and a HindIII-SapI fragment (Ubi1 (I) P-nosT-bla-ori) from pUbi_cass (Z. Li et. al., unpublished) were end-filled and ligated to produce pEU323b. A ClaI fragment (CaMV35S P-hph-nosT) from pWBVec8 was ligated to a ClaI linearised pEU309 vector fragment to produce pEU326b. A BamHI-SacI fragment (intron-containing Barnase) from pEU320a was ligated to an appropriately digested pEU323b vector fragment to produce pEU328. An NcoI-HindIII vector fragment from pEU307 (RB-ori-nptII-LB-Ds3’-GPA1-I), an NcoI partially digested fragment from pEU326b (uidA-nosT-CaMV35S P-hph (I)-nosT-sgfpS65T) and a HindIII-NcoI digestion fragment from pEU327a (GPA1-I-Ds5’) were ligated to produce pEU330an. An end-filled EcoRI-EcoRV fragment from pEU328 (specR-ori-RK2-Ubi1 (I) P-Barnase (I)-nosT) was then ligated to an end- filled BlpI (Bpu1102I) linearised pEU330an vector fragment to produce pEU334AN and pEU334BN. Unique RE recognition sites are in red colour.http://www.cambia.org/main/r_et_camvec.htm References: Hartley, R.W. (1988). Barnase and barstar. Expression of its cloned inhibitor permits expression of a cloned ribonuclease. J. Mol. Biol. 202, 913-915. Kumar, S.C. and Narayanan, K.K. (1997). Gene and enhancer traps for isolating genetic regions from rice. Rice Biotechnology Quarterly. 31, 17-18. Upadhyaya, N.M., Ramm, K., Gaudron, J., Craig, S., Wang, M-B., Gupta. S., Okita, T.W. and Waterhouse P.M. (1998). Can gfp replace uidA as a reporter gene to monitor transformation of cereals by biolistics or Agrobacterium? In: Proceedings of the 4th Asia-Pacific Conference on Agricultural Biotechnology (ed. P.J. Larkin), pp111-113. Wang, M.-B., Cheng, Z., Keese, P., Graham, M.W., Larkin, P.J. and Waterhouse P.M. (1998). Comparison of the coat protein, movement protein and RNA polymerase gene sequences of Australian, Chinese, and American isolates of barely yellow dwarf virus transmitted by Rhopalosiphum padi. Arch. Virol, 143, 1005-1013.

2. pHTTT3n 3214 bp sgfpS65T ori-bla nosT Eco R I (1) Hin d III (1027) Nco I (1017) pHTTT4n_spacer 4346 bp sgfps65T bla GPA1-I ori nosT Ds3 Hin d III (2944) Kpn I (26) Sal I (1) Sal I (2959) pACT cass 3941 bp bla Act1 P nosT Pst I (1260) Xho I (5) pBR322 ori II (2638) pMNK1007 5371 bp bla hph sgfpS65T ori CamV35S P nosT Bam H I (3590) Hin d III (2901) pBlueScript II KS (-) 2961 bp bla MCSKS ori Kpn I (760) Sac I (658) Sal I (735) pEU309 5596 bp UidA sgfpS65T bla pBR322 ori nosT Cla I (2172) Xho I (4563) Pst I (1877) Pst I (4866) -Continued CaMV35S T pCAMBIA1300 8958 bp hph nptII LB RB pBR322 bom pVS1 sta pBR322 ori pVS1 rep CaMV35S P Sac II (6317) Sca I (420) Sca I (6674) Sca I (6928) KpnI (17) pHTTT4n 3553 bp sgfpS65T GPA1-I Ds3 ori-bla nosT Sal I (365) Sal I (2526) pHTTT2n2 5819 bp uidA sgfpS65T GPA1-I ori-bla Ds3 LB nosT Kpn I (1110) Sac II (1) Sca I (2660) pTTT50N 11012 bp uidA nptII pBR322 bom pVS1 sta ori-bla LB RB pBR322 ori pVS1 rep nosT Hin d III (4046) Kpn I (4011) Sac II (10311) Ds3 pEU313d 3954 bp sgfpS65T bla GPA1-I ori Ds5-1 nosT Bam H I (3836) pEU308d 4876 bp bla hph sgfpS65T ori Ds5-1 nosT Hind III (4683) Bam H I (1) NcoI (373) NcoI (1042) Ds5-PCR product BamHIHindIII BamHI pEU321 5075 bp bla hph sgfpS65T ori Ds5-2 nosT Hin d III (1) Pst I (2174) Bam H I (195) Bam H I (394) pEU327a 4152 bp bla sgfpS65T GPA1-I ori Ds5-2 nosT Bam H I (1) Bam H I (3954) -Continued pHTTT1 5467 bp uidA sgfpS65T GPA1 -I ori-bla Ds3 nosT Sac I (4352) Sac II (4359) Nco I (5418) EcoRI (4402) EcoRI (2149) Nco I (4003) d III (1867)

3. pGEM ® -7Zf(-) 3000 bp bla Phage F1 Sac I (92) Bam H I (79) ori pEU323b 9102 bp nptII aadA (Spec R ) intronUbi1 P pBR322 ori ori RK2 nosT Bam H I (3346) Sac I (3335) pUbi1_cas 5631 bp Intron Ubi1 P pBR322 ori nosT Hin d III (2295) Sac I (271) SapI (2568) nptII pEU326b 7695 bp uidAsgfpS65T hph (I) bla 35S P pBR322 ori nosT Hin d III (5602) Cla I (1) Cla I (5597) Nco I (3426) Nco I (6655) pEU309 5596 bp UidA sgfpS65T bla pBR322 ori nosT Cla I (2172) pEU328 9620 bp Barnase (I) aadA (Spec R ) nptII intron Ubi1 P pBR322 ori ori RK2 nosT Eco R I (8827) Sac I (9092) Bam H I (1) Eco RV (5222) -continued Barnase (I) –PCR from pMT416 SacI BamHI PstI pEU319 3334 bp Barnase bla Phage F1 Pst I (3040) Sac I (1) Bam H I (2988) ori pWJKK IN-2 3269 bp nptII cat intron Pst I (737) Pst I (2723) Pst I (2789) Pst I (2979) ori pEU320a 3524 bp Barnase (I) bla cat intron Phage F1 Sac I (296) Bam H I (3283) Pst I (1) Pst I (3335) ori pEU327a 4152 bp bla sgfpS65T GPA1-I ori Ds5-2 nosT Bam H I (1) Bam H I (3954) HindIII (3760) NcoI (119)