Download presentation
Presentation is loading. Please wait.
Published byJulius Lester Modified over 9 years ago
1
How are navigation in networks and splicing in parasites related? Shai Carmi Bar-Ilan University Department of physics and the faculty of life sciences Summer 2010, USA
2
Navigation in networks with local information Navigation is important in communication networks, transportation networks, and social networks. Knowledge of the entire network is usually not feasible. Use greedy navigation. The Internet at the Autonomous Systems level Carmi et. al, PNAS 104, 11150 (2007) Boguna & Krioukov, PRL 102, 058701 (2009) MapQuest
3
Scale-free networks Nomenclature: In a network (graph), links (edges) connect nodes (vertices). The degree of a node, k, is its number of links. In the last decade, measurements showed that almost all natural networks are scale-free. Nodes in scale-free networks have degrees in all orders of magnitude, including nodes with an extremely large number of links (hubs). Degree distribution: Small γ: network is highly heterogeneous, many hubs exist. Large γ: network is homogeneous, fewer hubs, similar to purely random networks.
4
Navigation models 1.Navigating to the hub. S. Carmi., P. L. Krapivsky, and D. ben-Avraham, Physical Review E 78, 066111 (2008). 2.Kleinberg’s navigation model. S. Carmi, S. Carter, J. Sun, and D. ben-Avraham. Physical Review Letters 102, 238702 (2009).
5
How to find the most connected node in the network: an algorithm Start from a given node. Go to the neighbor with highest degree (break ties arbitrarily). Keep going, until reaching a peak- a node whose degree is greater than the degrees of all of its neighbors. Only knowledge of the neighbors degree is required! Basins of attraction are formed around each hub. a 23 2 1 2 2 3 4 1 1 2 2 1 3 1 2 a b c d e f g h i j k l m n o p
6
Example Courtesy of Hernan Rozenfeld
7
Who cares? Practical interest: Fast message routing to the most connected node (for example, wireless sensor networks). Theoretical interest: - A new decomposition procedure based on association to hubs. - Number and sizes of basins can be used to characterize networks. Rao et al., JMB 2004
8
Basins distribution in scale-free networks The giant basin How does the basins topology depend on the degree exponent γ (P(k)~k -γ )? For γ≤γ c ≈3 the largest hub attracts all nodes, forming a giant basin. For larger γ the network is fragmented to numerous basins whose size distribution decays as a power-law. Mathematically: The size of the largest basin scales as S~N δ, where δ=1 for γ≤ γ c and δ≈1/(γ-1) for large γ. The probability of a node to belong to a basin of size s is Q(s)~s -α for small s with α≈γ-1.
9
Theory- a transition at γ=3 We prove that the probability of a node of degree k to be a peak is approximately exp[-Ak 3-γ ], where A is a k-independent constant. For γ<3, the probability approaches zero- only the true hub is a peak. For γ>3, many nodes with large degree will be peaks. For large γ, we prove that the size of the largest basin scales as S~N 1/(γ-1). The first two moments of the number of basins and the number of solitary basins can be approximated analytically.
10
Deterministic fractal (u,v)-nets The behavior Q(s)~s -α can be explained using a fractal scale-free network model. Each link in generation n splits into u+v=w links in generation n+1.
11
A short summary Greedy search for the most connected node partitions the network into basins of attraction. For scale-free networks with γ<3, a giant basin exists (and thus greedy search works). For γ>3, there are many basins (corresponding to the network modules). The transition at γ=3 and the power-law distribution of small basin sizes can be analytically explained. The Internet and the glass network have a giant basin.
12
Generalization to lattices All degrees are equal. Node’s importance is determined by height or energy. Assume each node is attracted to its shortest neighbor. Basins of attraction have simple physical interpretation. valley peak saddle
13
A fun exercise in probability The number of valleys R(s): the probability of a node to be the valley of a basin of size s. In 1D, R(1)=1/30, and R(s) decays as 1/s!, much faster than the power-law for networks. In 2D, the density of peaks and valleys is 1/5, of saddles 1/15. R(1)=109/4290. Density of craters is 3/715. Density of ridges is 1/20.
14
The navigation problem and the Kleinberg model We know short paths exist in social networks (‘six degrees of separation’). But how do people find them? The Kleinberg model ( Nature 406, 845 (2000) ). * Underlying lattice; one long-range link for each node; long range link has length r with probability ~r --α. * Greedy navigation: message is always sent to the neighbor geographically nearest to the destination. Kleinberg proved (T- delivery time; d- dimension; L- lattice linear size) - For α=d, T ≤ ln 2 L. - For α≠d, T ≥ L x for some exponent x. For α=d, greedy navigation can find short paths! Accurate expression for the delivery time- an open problem for 9 years. We prove We also show that short paths can be found for α≠d if messages can be lost.
15
A sharp transition…
16
Trypanosoma brucei Parasitic eukaryotes that diverged 200-500 million years ago. Pathogens of the African Sleeping Sickness (30,000 deaths per year, best treatment is from 1916). Transfer from the gut of the Tsetse fly to the bloodstream of humans and cattle. Unique biology: - Kinetoplast - RNA editing with gRNA - Antigenic variation - trans-splicing From Mark Field’s lab website IAEA
17
mRNA processing T. brucei genes have no promoters. Gene expression is regulated by controlling mRNA stability and translation. Gene1 Gene2 Gene3 Gene4 Polycistronic Transcript AAAA SL Itai Dov Tkacz Trans-Splicing= And Polyadenylation=
18
Splicing overview SL- Spliced Leader RNA See also: Liang et. al, Euk. Cell (2003).
19
Open questions Where are the splice sites? Is there alternative trans-splicing?
20
Mapping transcript boundaries: a deep-sequencing approach Total RNA from insect-form Poly(A) + RNA selectionTerminator exonuclease treatment First strand cDNA synthesis with random hexamer or oligo(dT) primers First strand cDNA synthesis with random hexamer primers Second strand cDNA synthesis with RNaseH-derived RNA primers Second strand cDNA synthesis with SL primer cDNA fragmentation and size selection Addition of adapters and amplification Illumina sequencing ~30 million useful reads! N. G. Kolev, J. B. Franklin, S. Carmi., H. Shi, S. Michaeli, and C. Tschudi, PLoS Pathogens (in press).
21
Data analysis results 532 transcripts with misannotated start codon. 898 annotated genes not producing a transcript. 1,114 new transcripts, including conserved coding and non-coding. 394 genes with non-coding transcripts in their 3’UTR. Trans-splicing and polyadenylation of snoRNA clusters. Transcription initiation sites of the polycistronic units. Digital gene expression.
22
Splice-site composition PPT No signal observed in the exon, except for small purine excess. No G at -3 Non AG splice-sites due to sequencing errors and strain differences. Pyrimidine peak at about -25, distance from AG varies: unique to trypanosomes. PolyPyrimidine Tract The 3’-splice site 5’UTR ORF Human
23
Splice site composition Median- 43ntsMedian- 18nts Define the PPT as the longest stretch of pyrimidines (separated by no more than one purine) in the 200nts upstream of the splice site.
24
UTRs Median- 130ntsMedian- 388nts
25
Alternative splicing Uncertainty of splice-site usage: (Shannon entropy).
26
Alternative splicing 0 20 40 60 -300-100100300 ATG nt position relative to START codon relative usage of trans-splice sites % Sites near the ORF are stronger. Some sites are found in frame. Alternative splicing “ dispersion ”: average distance (nts) of all weak splice sites from the strongest one. Position relative to primary splice site, nt -150 150 Gene number
27
Why alternative splicing? Usually does not create protein isoforms. Noise? Regulatory role? - Affinity of splice sites could depend on environmental conditions. - Different 5’UTRs can carry sequences that determine the fate of the mRNA. Future studies will find out whether splice sites usage varies between environments, life cycles, and strains.
28
Polyadenylation sites Median 142nts
29
Summary Deep sequencing of Trypanosoma brucei mRNA reveals the transcriptome of the parasite at single nucleotide resolution. Hundreds of genes reannotated. Splice sites and polyadenylation sites mapped for the first time. Splice site sequence is HAG. PPT length and distance from splice site highly variable. Considerable amount of alternative splicing previously unpredicted. Polyadenylation occurs preferentially at adenosynes but location is highly irregular. Evidence for coupling of polyadenylation and trans-splicing of the downstream gene.
30
Does splicing regulate gene expression? Splicing factor silenced Gene expression is regulated by the presence of splicing factors. What is the molecular mechanism? No significant sequence motifs.
31
Downregulation Tb11.02.1100- nucleobase/nucleoside transporter 8.1. Downregulated in all lines. Regulatory sequence: CAGTATCATCCCCACTTAAGGAAACTGTAAGCTTAGT CACTTCCCTCCTTTCTCTTTCTTTTTGTACGAAGGTT AAAGCCACAAGACTCTCTTACTGAACTCAGGCAAGT GAACAACACCGCACTAAACCAGAATCGCATAAGTTA CATCCACTATCCATCCACTCGGGTTTAACTGAATTGC ATCGCTGGATACCTTTCGTGTGCAATG Polypyrimidine tract (PPT) 3’-splice site START codon 5’-UTR C-rich PPT! Particularly short PPT-AG distance!
32
Hypothesis Binding of splicing factors (U2AF65) to the PPT is weak because of the short distance to the AG. Binding of PTB (PPT Binding) protein to its target- the C-rich PPT is required for efficient splicing. Knockdown of U2AF65 or PTB1 decreases splicing factors affinity and splicing efficiency. Rest of intronPPTAG5’UTR Rest of intronPPTAG5’UTR Normal Short PPT-AG distance and C-rich PPT
33
Experiment design promoterintron5’UTRreporterAG Procyclin Tb11.02.1100Luciferase PPTspacer intron5’UTRreporterAG TTTTTTTTTspacer promoter intron5’UTRreporterAG PPTspacer Transfect constructs into U2AF65 silenced cells. 1 2 3 Expect: (1) Downregulation of luciferase activity in response to U2AF65 silencing. (2-3) Elimination of downregulation.
34
Upregulation Tb927.7.1110- Asparagine synthetase a, putative. Upregulated in U2AF65.
35
Hypothesis Biochemical evidence that upregulation is due to cytoplasmatic binding of U2AF65 to the 3’UTR of the mature mRNA. U2AF65 binding expected when trans-splicing occurs in the 3’UTR. Possible that U2AF65 binding to 3’UTR of mature mRNA responsible for downregulation of the species with the downstream polyadenylation site. ORF3’UTRPPT3’UTR mRNA species degraded in the presence of U2AF65 5’UTRPolyA tail ORF3’UTR5’UTRPolyA tail Other species
36
Experiment design promoterIntron+5’UTR reporter Procyclin Luciferase 1 2 Tb927.7.1110 3’UTR PA PPT promoterIntron+5’UTR reporterPA Transfect constructs into U2AF65 silenced cells. Expect: (1) Upregulation of luciferase activity in response to U2AF65 silencing. (2) Elimination of upregulation. Results are expected in the upcoming few months.
37
Summary The mapping of splice sites and polyadenylation sites by deep sequencing improves our understanding of these processes. The presence/absence of specific splicing factors regulates the expression of some genes. Regulation is likely to be related to structural features of the mRNA rather than sequence motifs. Model genes were selected for which we have conjectures about the molecular mechanism of regulation. Reporter gene assays are carried out to test these conjectures.
38
Acknowledgements Navigation in networks Prof. Daniel ben-Avraham (Clarkson University, NY) students: Dr. Hernan Rozenfeld, Stephen Carter, Jie Sun Prof. Paul Krapivsky (Boston University) Splicing in trypanosomes Prof. Shulamit Michaeli (Bar-Ilan) students: Sachin Kumar-Gupta, Asher Pivko, Ilana Naboishchikov Prof. Elisabetta Ullu, Prof. Christian Tschudi (Yale) staff: Dr. Joseph Franklin, Dr. Nikolay Kolev, Dr. Huafang Shi Thesis advisor: Prof. Shlomo Havlin (Bar-Ilan). Funding: Adams Fellowship Program of the Israel Academy of Sciences and Humanities
39
Thank you for your attention!
40
My research interests Networks Modeling Flow Diffusion Percolation Disease spreading Navigation Data analysis The Internet Glass models Biology (general) Protein interaction (comp) DNA editing (comp) Trypanosomes Unfolded protein response (comp + expr) Splicing regulation (comp + expr) Mapping alternative splicing (comp) Diffusion Anomalous functionals (theory) Microscopy (biophysics)
41
Random network models In a network, links (edges) connect computers/individuals (nodes). 1. Simplest model: a regular lattice. * Good for purely spatial, local interactions. 2. Erdos-Renyi (ER) network model (G N,p ): fully random. * Number of nodes N, probability of link p. * Narrow degree distribution (Poisson). 3. Scale-free (SF) networks: emergence of hubs. * Broad degree distribution: * Nodes with extremely high degree exist (hubs). * Found to describe most real-world systems.
42
Basins of attraction vs. community detection The calculation of the basins of attraction provides a decomposition of the network. How does it compare with state of the art community detectors? Most community detectors use global information. More importantly, community detection and separation to basins have different goals. Consider this example: Community detectors: Maximize links within communities; minimize links between communities. Basins of attraction: Separate nodes by the hub they associate with. Not really two communities!
43
Tie breaking What happens when the neighbor of highest degree of a node has the same degree as the node itself? In our local search, a node can be a peak even if it has neighbors of equal degree. In a recursive search, we surf over “ridges” of connected nodes of equal degree to reach the true hub. Less basins exist, but other results remain qualitatively the same. 32212 1 1 2 322122 1 1
44
2D random surface example
45
Kleinberg model simulations Our solution agrees with numerical results (navigation simulations and iteration of the master equation).
46
Message loss probability Kleinberg’s model is unrealistic: why does the network need to be fine-tuned (have α=d) for greedy routing to work? The missing ingredient- message loss probability. We calculated T z (L) analytically, where z is the probability of successful completion of a single step. The system is small-world for a much wider range of α! Explains why the system need not be fine-tuned to become navigable. No message loss With message loss z=0.9, 1D
47
Splicing machinery and sequence Yeast conserved branch site: TACTAAC mammalian
48
Splicing regulation splicing enhancersplicing silencer SR proteins create ’bridges’ to stabilize the spliceosome hnRNP In trypanosomes: U2AF65 and 35 exist and do not interact. U2AF65 interacts with SF1. Interacting SR proteins were identified. hnRNP proteins exist.
49
Predicting splicing heterogeneity What determines if a gene will be differentially spliced? Look at 100nts up- and down-stream the strongest site. Rank all potential splice sites: TAG-3, AAG, CAG-2, GAG-1. heterogeneity rank of a gene = sum of ranks of all other AG dinucleotides / rank of strongest site. Average heterogeneity rank about 10 for high uncertainty genes, but only about 7 for low uncertainty genes (P=10 -20 ). Signatures do not look meaningful, but analysis shows that longer 5’UTRs, shorter PPTs, and longer PPT-AG distance also contribute significantly to heterogeneity.
50
Explaining abundance A-rich exons are more abundant. Other correlations: Genes with longer PPT and shorter 5’UTR are more abundant. Splice-site ambiguity is anti-correlated with abundance. Dispersion Abundance
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.