1. IMGT, the global reference in immunogenetics and immunoinformatics http://www.imgt.org Sofia Kossida IMGT Director Professor, Montpellier Universtity, IGH CNRS, Montpellier, France Marie-Paule Lefranc IMGT Founder and Director Emeritus Professor, Montpellier University, IGH CNRS, Montpellier, France February 10, 2015 Montpellier OMIS days http://www.imgt.org

2. IMGT®: the adaptive immune response Immunoglobulin (IG) B lymphocyteT lymphocyte T cell receptor (TR) MH peptide Trimolecular complex TR/pMH Vertebrates http://www.imgt.org

3. Immunoglobulin (IG) synthesis 2 x 10 12 DIFFERENT ANTIBODIES 5'5'3'3' x 1000 6300 POTENTIAL RECOMBINATIONS N-DIVERSITY SOMATIC MUTATIONS ABOUT POSSIBILITIES 3.5 x 10 5 ABOUT POSSIBILITIES 6.3 x 10 6 185 +165 150 FUNCTIONAL IG GENES 5' 3' VDJC 38-46 x 23x 6 30 - 35 x 5 Kappa 29--33 x 4 -5 Lambda 5' 3' VJC HEAVY CHAIN LIGHT CHAIN IMGT Repertoire, http://www.imgt.org http://imgt.cines.fr http://www.imgt.org

4. 7 databases 17 online tools 15,000 web pages Sequences Genes Structures Immunoglobulins (IG) (or antibodies) T cell receptors (TR) MH IgSF and MhSF IMGT® created in 1989

5. IMGT-ONTOLOGY seven axioms: To share, reuse and represent knowledge in Immunogenetics and Life Sciences CLASSIFICATION NUMEROTATION DESCRIPTION ORIENTATION LOCALIZATION Giudicelli and Lefranc, Bioinformatics (1999) IDENTIFICATION OBTENTION http://www.imgt.org

6. group subgroup allele locus is a member of an instance of is a member of an instance of is a variant of an instance of is ordered in an instance of IGLV IGLV2 IGLV2-11 IGLV2-11*02 human IGL (22q11.2) is ordered in is a member of is a variant of is a member of gene « Concepts »« Instances » http://www.imgt.org Concepts of CLASSIFICATION

7. 1.group, subgroup, gene, allele 2.nomenclature for the V, D, J and C genes 3.immunoglobulin (IG) and T cell receptor (TR) genes 4.IMGT gene names approved by HUGO Nomenclature Committee (HGNC) in 1999. 5.IMGT alleles validated by WHO-IUIS/IMGT-NC IMGT/GENE-DB: international reference database for IG and TR genes (direct links from NCBI Gene) and alleles. http://www.imgt.org

8. Concepts of DESCRIPTION IMGT labels (capital letters) http://www.imgt.org IMGT Prototypes (table) IMGT Scientific chart, http://www.imgt.org

9. Concepts of DESCRIPTION 1. standardized IMGT labels 2. used in all IMGT® databases and tools nucleotide and amino acid sequences (IMGT/LIGM-DB…) 2D and 3D structures (IMGT/3Dstructure-DB…). 3. Sequence Ontology (SO) includes IMGT labels. 4. IMGT® databases can be queried using labels (a big ‘plus’ compared to generalist databases). http://www.imgt.org

10. DESCRIPTIONDESCRIPTION IMGT/LIGM-DB IMGT-ONTOLOGY: 277 IMGT labels for sequences 285 IMGT labels for 3D structures 175 897 sequences from 346 species http://www.imgt.org

11. Lefranc et al. Dev. Comp. Immunol. 27, 55-77 (2003) CDR-IMGT lengths [8.10.12] 1. IMGT unique numbering 2. IMGT Collier de Perles (first one in 1997) http://www.imgt.org Concepts of NUMEROTATION

12. Lefranc et al. Dev. Comp. Immunol. 27, 55-77 (2003) CDR-IMGT lengths [8.10.12] - conserved AA (and codons) always at the same positions : 23 1st-CYS 41 CONSERVED-TRP 89 hydrophobic 104 2nd-CYS 118 J-PHE, J-TRP - six anchors: delimitation of the FR-IMGT and CDR-IMGT CDR-IMGT lengths are crucial information http://www.imgt.org Concepts of NUMEROTATION 1. IMGT unique numbering 2. IMGT Collier de Perles (first one in 1997)

13. View from above the CDR-IMGT Side view of the V-DOMAIN V-J junction V-D-J junction V-DOMAIN: VH and V-KAPPA CDR: complementarity determining region CDR3-IMGT (105-117) V-D-J junction (104-118), V-J junction (104-118) V-KAPPA VH V-KAPPA VH http://www.imgt.org IMGT® http://www.imgt.org

14. JUNCTION gatt tgtgcgaaa gtggtgactgctat actcctgg 3’V-REGION D-REGION 5’J-REGION agcatattgtg acaactggttcg Immunoglobulin V-D-J generation of sequence diversity N-REGION tcc tacc N-REGION ga C A P Y R G D T Y D Y S W tgtgcgccaggggtgactactat tgt gcg cca tac cgg ggt gac act tat gat tac tcc tgg http://www.imgt.org

15. Yousfi Monod et al. Bioinformatics 20, i379-i385 (2004) IMGT/JunctionAnalysis: analysis of the IG and TR junctions http://www.imgt.org

16. The 11 IMGT physicochemical AA classes Pommié et al. J. Mol Recognit. 17, 17-32 (2004) http://www.imgt.org

17. IMGT/JunctionAnalysis Yousfi Monod et al. Bioinformatics 20, i379-385 (2004) Pommié et al. J. Mol Recognit. 17, 17-32 (2004) http://www.imgt.org Analysis of the IG and TR junctions

18. V-REGION identity percent IMGT/DomainGapAlign http://www.imgt.org

19. IMGT Collier de Perles AA that are different compared to the closest germline V and J genes and alleles (e.g. for alemtuzumab: 11 AA in CDR1- and CDR2-IMGT and 14 AA in the FR-IMGT, compared to Homo sapiens IGHV4-59*01) IMGT/DomainGapAlign: http://www.imgt.org Towards «Potential immunogenicity evaluation» Ehrenmann et al. Nucl. Acids Res. 38, D301-307 (2010)

20. IMGT/DomainGapAlign http://www.imgt.org very similar (+ + +) similar (+ - +), (+ + -) dissimilar (+ - -), (- + -), (- - +) very dissimilar (- - -) Towards «Potential immunogenicity evaluation» Characteristics of the AA class changes: Ehrenmann et al. Nucl. Acids Res. 38, D301-307 (2010) (Hydropathy Volume Physicochemical) + : conserved classes - : different classes

21. IMGT/3Dstructure-DB http://www.imgt.org

22. IMGT/3Dstructure-DB Hydrogen bonds http://www.imgt.org Lefranc et al. Nucl. Acids Res. 37, D1006-1012 (2009) V-DOMAIN

23. Contacts VH-(Ligand), V-KAPPA-(Ligand) http://www.imgt.org

26. International Nonproprietary Name (INN) Ehrenmann et al. Nucl. Acids Res. 38, D301-307 (2010) IMGT/2Dstructure-DB WHO-INN programme requires the CDR-IMGT lengths for antibodies. http://www.imgt.org

27. Ehrenmann et al. Nucl. Acids Res. 38,D301-307 (2010) IMGT/2Dstructure-DB http://www.imgt.org

28. Ehrenmann et al. Nucl. Acids Res. 38, D301-307 (2010) IMGT/2Dstructure-DB DESCRIPTION CLASSIFICATION NUMEROTATION

29. Ehrenmann et al. Nucl. Acids Res. 38, D301-307 (2010) IMGT/mAb-DB

30. Ehrenmann et al. Nucl. Acids Res. 38, D301-307 (2010)

32. Acknowledgements BioSTIC-LR ACI IMPbio GIS AGENAE Plan Pluri-Formation Université Montpellier 2 ANR FLAVORES ANR BIOSYS GIS IBiSA Grand Plateau Technique Régional Languedoc-Roussillon GPTR «ImmunoGrid», 6th PCRDT, STREPS IST http://www.imgt.org and the companies that support the IMGT efforts of standardization.