Download presentation
Presentation is loading. Please wait.
Published byJanis Conley Modified over 9 years ago
1
Protein Synthesis What is RNA Function of RNA Types of RNA What is protein synthesis Process of protein synthesis Where does the processes occur in the cell occur in the cell
2
RNA RNA: ribonucleic acid Function: uses the information provided by DNA to make proteins. DNA to make proteins.Structure: 1. Consists of many nucleotides 1. Consists of many nucleotides 2. sugar is Ribose 3. has the base Uracil rather than Thymine 3. has the base Uracil rather than Thymine 4. one strand of nucleotides
3
RNA Continued 3 forms of RNA 1. mRNA: Messenger RNA - single, uncoiled - transmits info from DNA to make proteins proteins 2. tRNA: Transfer RNA - hairpin form - carries amino acids in the cytoplasm to ribosomes to make proteins ribosomes to make proteins 3. rRNA: Ribosomal RNA - globular shaped - makes up ribosomes, function unknown
4
Differences between RNA and DNA RNA consists of 1 strand of nucleotides; DNA has 2 strands of nucleotides RNA has the sugar ribose; DNA has the sugar deoxyribose RNA has the base URACIL; DNA has the base THYMINE So:: A-T DNA So:: A-T DNA A-U RNA A-U RNA RNA exists in 3 forms; DNA exists in only 1 form EX: ATCGTTAACGCCTATCGAA UAGCAAUUGCGGAUAGCUU UAGCAAUUGCGGAUAGCUU
5
Making RNA Process is called transcription Uses DNA Occurs in the nucleus Process 1.RNA polymerase (enzyme) attaches to a DNA molecule and breaks it apart. 2.RNA polymerase attaches to 1 strand of DNA and reads it one base at a time. It bonds the correct complementary base to make RNA 3.When RNA reaches the termination signal, it stops transcribing and detaches from the DNA strand. Ex: DNA: ATTCGTCTGCAATCGCTA RNA: UAAGCAGACGUUAGCGAU RNA: UAAGCAGACGUUAGCGAU
6
Transcription
7
Protein Synthesis To make proteins Assembly of amino acids into a specific form to make proteins Remember: amino acids are the building blocks of proteins After transcription occurs (the making of RNA) translation occurs
8
Protein Synthesis
9
Process of Making Proteins: Translation Occurs in ribosomes mRNA provides the necessary information: carries info from DNA. Steps in the process: 1. rRNA binds to mRNA 2. a ribosome moves along the mRNA molecule and reads 3 bases at a time. 3. these 3 bases are called a CODON. Codons provide a code for specific amino acids. Not all codons code for amino acids, some provide a code to start and stop the process. 4. At each codon (3 bases) an amino acid is added to the chain. Amino acids are brought to the mRNA by the tRNA. tRNA contains an anitcodon: 3-bases that are complementary to the mRNA codon. 5. This process continues until a stop codon is reached. 6. Once the process is finished, the mRNA disintegrates and the protein is left to float in the cytoplasm.
10
Protein Synthesis Example DNA TACGATAAAATGCCGCGGCATATTCGTATC DNA TACGATAAAATGCCGCGGCATATTCGTATC RNA AUG/CUA/UUU/UAC/GGC/GCC/GUA/UAA/GCA/UAG RNA AUG/CUA/UUU/UAC/GGC/GCC/GUA/UAA/GCA/UAG Break down into 3 bases at a time to make a protein AUG: Start UAA: Stop AUG: Start UAA: Stop CUA: LeucineGCA CUA: LeucineGCA UUU: PhenylalanineUAG UUU: PhenylalanineUAG UAC: Tyrosine UAC: Tyrosine GGC: Glycine GGC: Glycine GCC: ALanine GCC: ALanine GUA: Valine GUA: Valine
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.