1. Caroline Goutte The Power of a Genetic Model System: Using Soil Nematodes to Discover Genes Involved in Human Alzheimer’s Disease

2. I. The Worm as a Model System II. The Power of Genetic Analysis III. An Example: Research Project: Genetic Analysis of Cell Communication Processes in C. elegans Leads to the Identification of Genes Important for Human Alzheimer’s Disease Overview

3. Biology at the cellular/molecular level In order to understand these molecules and processes: Use a MODEL SYSTEM Simplicity Experimentation In order to understand these molecules and processes: Use a MODEL SYSTEM Simplicity Experimentation All species share the same fundamental molecular components and molecular processes

4. Model Systems for studying fundamental questions of biology at the genetic level –Escherichia coli and bacteriophage (bacteria and their viruses) –Saccharomyces cerevisiae (baker’s yeast) –Caenorhabditis elegans (nematode worm) –Drosophila melanogaster (fruit fly) –Mus musculus (mouse) All amenable to traditional and molecular genetic analysis All have attracted a critical mass of investigat ors All had their genomes fully sequenced by 2002

5. Part of the success of molecular genetics was due to the use of extremely simple organisms which could be handled in large numbers: bacteria and bacterial viruses. The processes of genetic replication and transcription, of genetic recombination and mutagenesis, and the synthesis of enzymes could be studied there in their most elementary form, and, having once been discovered, their applicability to the higher forms of life could be tested afterwards. We should like to attack the problem of cellular development in a similar fashion, choosing the simplest possible differentiated organism and subjecting it to the analytical methods of microbial genetics. Thus we want a multicelluar organism which has a short life cycle, can be easily cultivated, and is small enough to be handled in large numbers, like a micro-organism. It should have relatively few cells, so that exhaustive studies of lineage and patterns can be made, and should be amenable to genetic analysis. We think we have a good candidate in the form of a small nematode worm… Although the total number of cells is only about a thousand, the organism is differentiated and has an epidermis, intestine, excretory system, nerve and muscle cells. Sydney Brenner early 1960s “…nearly all the ‘classical’ problems of molecular biology have either been solved or will be solved in the next decade…the future of molecular biology lies in the extension of research to other areas of biology, notably development and the nervous system.”

6. Caenorhabditis elegans introduced in 1963 by Sydney Brenner A new model system specifically chosen for its simplicity Goal: the genetic dissection of development and behavior Success: Today’s “Worm Community” ~15,000 scientists 3 Nobel Prizes (‘02, ‘06, ‘09) Features: –Size: 1 mm in length –Generation time: 3 days –Life Span: 2-3 weeks –~300 progeny per generation –Cultivate in lab on petri dishes –Transparent –Only 959 cells!

7. B. Goldstein, UNC

8. 3 Unique Tools that made C. elegans a powerful model system: Complete Cell Maps Complete Cell Lineages Complete Genome Sequence

9. Tool #1: Detailed Map of Worm Anatomy single-cell resolution (completed by John White, 1986) 959 somatic cells (neurons, muscles, intestinal cells, epidermal cells, etc.)

10. Tool #2: Cell Lineage Maps Each cell’s lineage can be traced back to the fertilized egg (completed by John Sulston, 1983)

11. 1 sec = 1 hr. B. Goldstein, UNC

12. fertilized egg time ABP1 ABaABp EMS P2 EMS P2 ABp ABa

13. fertilized egg 959 somatic cells in adult hermaphrodite

15. December 11, 1998 Tool #3: Complete Genome Sequence (completed by C. elegans Sequencing Consortium, 1998) Model System Genome sequence completed Genome Size (Mb) (x 10 6 ) Number of genes Gene Density (Kilobases per gene) S. cerevisiae (yeast) 199712 60002 C. elegans1998100~20,0005 D. melanogaster (fruit fly) 2000140 ~14,00010 M. musculus (mouse) 20022500~25,000100 H. sapiens20013000~25,000120

16. Genes encode proteins that drive biological processes Genetic Analysis We can learn about specific gene function by studying the effect of gene mutations: normal gene normal function defective gene aberrant function normal gene normal function defective gene aberrant function

17. Genetic Analysis: Two different approaches disrupt gene X normal gene normal function defective gene aberrant function normal gene normal function defective gene aberrant function discover the function of gene X normal gene normal function defective gene aberrant function normal gene normal function defective gene aberrant function find disrupted function X find disrupted function X discover genes responsible for function X discover genes responsible for function X I II

18. Genetic Analysis: Two different approaches disrupt gene X normal gene normal function defective gene aberrant function normal gene normal function defective gene aberrant function discover the function of gene X Use targeted mutagenesis or RNAiObserve effect on phenotype * Adapt to High Throughput version Start with GENE of interest: What is the function of gene x ? I

19. normal gene normal function defective gene aberrant function normal gene normal function defective gene aberrant function find disrupted function X find disrupted function X discover genes responsible for function X discover genes responsible for function X Start with PROCESS of interest: What gene products are involved in process x? The Mutant Hunt: 1) predict mutant phenotype 2) perform random mutagenesis 3) collect desired phenotype 4) identify responsible genes II

20. Genetic Analysis: Two different approaches disrupt gene X normal gene normal function defective gene aberrant function normal gene normal function defective gene aberrant function discover the function of gene X normal gene normal function defective gene aberrant function normal gene normal function defective gene aberrant function find disrupted function X find disrupted function X discover genes responsible for function X discover genes responsible for function X II I

21. An example Research Question: What are the molecules that mediate cell communication?

22. pharynx mouth

23. from Z.F. Altun & D.H. Hall and from S. Mango

24. ?

25. anterior pharynx posterior pharynx mouth

26. ABp

30. cell communication How?

31. cell communication How? normal gene normal function defective gene aberrant function normal gene normal function defective gene aberrant function find disrupted Cell communication find disrupted Cell communication discover genes responsible for Cell communication discover genes responsible for Cell communication What genes are required?

32. 1) Random mutagenesis of C. elegans genome (20,000 genes) 2) Search through thousands of worms 3) Find mutants that have aberrant pharynx morphology Genetic Mutant Screen

33. wild type: mutants: aph-1 - aph-2 - glp-1 - lag-1 - lag-2 - pen-2 - sel-12 - sup-17 - The products normally encoded by these genes are responsible for mediating the cell communication event What are these products? …turn to the gene sequence for clues

34. What type of protein is encoded by each gene?  Identify the gene in genome  Study DNA sequence to predict gene product  Compare to gene databases glp-1

35. DNA sequence of the glp-1 gene atgcgagttcttctaattttactcgcgttttttgcgccaatcgccagtcaacttatgggtggagaatgcggaagggaaggtgcttgctccgtcaatggaaaatgctataatg gaaaactgattgagacatactggtgccgttgcaaaaaaggattcggaggtgctttctgtgaacgtgaatgcgatttggattgtaaacgaggcgagaagtgcatctacg atgtttatggtgaaaatccgacgtgtatctgtcaagattgcgaagacgagactcctccaacagaacgtactcaaaaaggctgtgaagaaggctatggaggtcctgact gcaaaactcctctattttcgggagtaaatccatgcgattcggatccttgcaacaacggactctgctatccattctatggtggatttcagtgcatatgcaacaatggatatgg aggatcgtattgtgaagaaggaatcgatcattgtgctcaaaatgaatgcgcagaaggttcaacgtgtgtcaatagtgtatacaactattactgtgattgcccaattggaa aatccggtcgatattgtgaacgaactgaatgtgctttgatgggaaacatttgcaatcatggaagatgtattccgaacagagatgaagacaagaacttcagatgtgtatg cgactcgggatacgagggagaattttgcaataaggataaaaacgaatgcctcatcgaagaaacgtgtgttaacaactctacatgtttcaatttgcacggtgattttactt gtacctgtaaacctggatacgctggaaagtattgcgaggaggctatcgacatgtgcaaggattacgtttgccaaaatgatggatactgtgcccatgactcgaatcagat gccaatttgttattgcgaacaaggattcactggacaacgatgtgagattgagtgtccttcaggattcgggggaattcattgtgatcttccactacagagaccacactgctc tcggagcaatggaacgtgttacaacgatggaagatgtataaatggtttctgtgtctgtgaacctgattatattggagatcgatgtgagattaataggaaagatttcaag Predict Protein sequence of the glp-1 gene product MRVLLILLAF FAPIASQLMG GECGREGACS VNGKCYNGKL IETYWCRCKK GFGGAFCERE CDLDCKRGEK CIYDVYGENPTCICQDCEDE TPPTERTQKG CEEGYGGPDC KTPLFSGVNP CDSDPCNNGL CYPFYGGFQC ICNNGYGGSY CEEGIDHCAQNECAEGSTCV NSVYNYYCDC PIGKSGRYCE RTECALMGNI CNHGRCIPNR DEDKNFRCVC DSGYEGEFCN KDKNECLIEETCVNNSTCFN LHGDFTCTCK PGYAGKYCEE AIDMCKDYVC QNDGYCAHDS NQMPICYCEQ GFTGQRCEIE CPSGFGGIHCDLPLQRPHCS RSNGTCYNDG RCINGFCVCE

36. glp-1 gene encodes a cell surface receptor protein Extracellular Intracellular cell membrane

37. glp-1 gene encodes a cell surface receptor protein Extracellular Intracellular C.elegans 2 Notch genes cell membrane Evolutionarily conserved Family of “Notch” Receptors Mammals 4 Notch genes J. Kimble et al., U. Wisconsin, 1987 J. Priess et al., MRC England, 1987 I. Greenwald et al., Columbia U., 1989

38. Notch Receptor Protein on cell surface receives a signal signaling cell

39. Notch Receptor Protein on cell surface receives a signal

40. wild type: mutants: aph-1 - aph-2 - glp-1 - lag-1 - lag-2 - pen-2 - sel-12 - sup-17 - The products normally encoded by these genes are responsible for mediating the cell communication event What are these products? …turn to the gene sequence for clues

41. signaling cell responding cell Notch target gene regulation Cleavage I Cleavage II What types of proteins do these genes encode, and what do they do? LAG-1 SEL-12 SUP-17 LAG-2 more genes: aph-1 and aph-2 more genes: aph-1 and aph-2

42. aph-1 is predicted to encode a 7-pass trans-membrane protein Look for aph-1-like genes in genomic databases: Eureka! aph-1 is a conserved gene (Human and Drosophila genes now receive a name: “Aph1” !)

43. aph-2 is predicted to encode a large extracellular protein that is anchored to the membrane Look for aph-2-like genes in genomic databases: Eureka! aph-2 is a conserved gene membrane spanning glycosylations

44. signaling cell responding cell Notch target gene regulation Cleavage I Cleavage II What is the molecular role of APH-1 and APH-2 ? LAG-1 SEL-12 SUP-17 LAG-2 APH-2 APH-1 ?

45. And now for something completely different…. (or so we thought) Studies of Alzheimer’s disease…

46. Alzheimer’s Disease Neurodegenerative dementia Amyloid Plaques in brain tissue Abnormal accumulation of amyloid  protein ( A  ) Small % of AD patients have early onset AD because they inherited an aberrant gene that increases the amount of aggregating A  What are these genes? 1) APP (amyloid precursor protein) 2) Presenilin can these genes lead us to understand the molecular mechanisms that lead to AD?

47. APP encodes a small membrane-anchored protein that gets cleaved to release A  protein Presenilin is a membrane-bound protein that cleaves APP presenilin aberrant cleavage yields neurotoxic A  amyloid plaques in Alzheimer’s disease amyloid precursor protein APP Cleavage I Cleavage II AA Drug design? How does it work? presenilin = human version of sel-12, (the C. elegans protein that cleaves Notch Receptor !) Levitan and Greenwald, 1995

48. How does presenilin cleave APP? Who are its collaborators ? presenilinNicastrin Protein biochemistry using presenilin as fishing bait: discover an interacting protein: “Nicastrin” Yu et al., 2000 presenilin ? 200 kD 97 kD 55 kD 36 kD 21 kD immune pre -immune 12 PS1-FL PS1-NTF PS1-CTF a b APP Cleavage I  presenilin Nicastrin Cleavage II

49. What type of protein is Nicastrin ? Determine gene sequence Look in databases for similar genes Instant Lessons:  human Nicastrin must function in Notch-mediated cell communication  APH-2’s molecular role in cell communication is clearer: APH-2 forms a complex with with sel-12 human Nicastrin = C. elegans APH-2 !

50. signaling cell responding cell Notch target gene regulation Cleavage I Cleavage II What is the molecular role of APH-1 and APH-2 ? LAG-1 SEL-12 SUP-17 LAG-2 APH-2 APH-1 ? APH-2

51. signaling cell responding cell Notch target gene regulation Cleavage I Cleavage II APH-1 and APH-2 interact with presenilin/sel-12 to form a molecular machine that cleaves cell surface proteins (Notch Receptor, APP, etc.) LAG-1 SEL-12 SUP-17 APH-2 APH-1

52. Model of  -Secretase Quartet SEL-12 APH-2 APH-1

53. Model of  -Secretase Quartet Presenilin SEL-12 APH-1 APH-2 Nicas. PEN-2 Alzheimer’s Disease  study of inherited form  Presenilin/SEL-12 (Sherington et al.’95; Levy-Lahad et al., ’95; Rogaev et al., ‘95)  protein biochemistry  Nicastrin/APH-2 (Yu et al., ’00) Cell Communication via Notch Receptor  C. elegans model system  hunt for mutants  sel-12 (Levitan et al., ‘95)  aph-2 (Goutte et al., ‘00)  aph-1 (Goutte et al., ’02; Francis et al., ‘02)  pen-2 (Francis et al., ’02)

54. Useful Websites: http://www.wormclassroom.org designed for teachers (high school - college) great introduction, pictures and movies, and computer-based exercises, http://www.wormbase.org gateway to all C.elegans reseach tools searchable - by author, by cell, by gene, etc. http://elegans.swmed.edu more simple gateway - good introductions to worms http://www.wormatlas.org beautiful images and explanations of all the worm cells, tissues, major anatomical descriptions http://www.bio.unc.edu/faculty/goldstein/lab/movies.html great movies (single-cell divisions as well as whole worm)

55. 1 sec = 1 hr.

58. An example: where is the “HSN neuron” 8000 prints from serial section electron micrographs

59. HSN in adult Lineage of the HSN cell