2. Regents Biology From gene to protein: transcription translation protein

3. Regents Biology Transcription  Making mRNA from DNA  DNA strand is the template (pattern)  match bases  U : A  G : C  Enzyme  RNA polymerase

4. Regents Biology Transcription  Occurs in the nucleus  3 stages  Initiation  Elongation  termination

5. Regents Biology Transcription  Initiation  DNA is unwound and unzipped in the area of the gene to be transcribed by RNA polymerase which binds to the promoter region “upstream” of gene (promoter region signals which DNA strand is to be copied)  Region has a high concentration of A’s & T’s (called the TATA box)

6. Regents Biology Matching bases of DNA & RNA  Double stranded DNA unzips AGGGGGGTTACACTTTTTCCCCAA

7. Regents Biology Matching bases of DNA & RNA  Double stranded DNA unzips AGGGGGGTTACACTTTTTCCCCAA

8. Regents Biology Transcription  Elongation  With 1 DNA strand serving as the “template strand”  RNA polymerase attaches ribonucleotides in 5’ to 3’ direction  By complementary base pairing

9. Regents Biology Matching bases of DNA & RNA  Match RNA bases to DNA bases on one of the DNA strands U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A

10. Regents Biology

11. Matching bases of DNA & RNA  U instead of T is matched to A TACGCACATTTACGTACG DNA AUGCGUGUAAAUGCAUGC mRNA UCCCCCCAAUGUGAAAAAGGGGUU ribosome

12. Regents Biology Transcription  Termination  RNA polymerase transcribes the DNA sequence up to the end of the gene where a “terminator sequence” is encountered mRNA transcript is released from DNA Strand  Prokaryotes & eukaryotes have different terminator sequences

13. Regents Biology mRNA modification  In eukaryotes, mRNA is modified prior to leaving the nucleus (ensuring it remains intact) 1. Capping  A 5’ cap is added to the start of the primary transcript (protects mRNA from digestion as it exits the nucleus and enters the cytoplasm)

14. Regents Biology mRNA modification  In eukaryotes, mRNA is modified prior to leaving the nucleus (ensuring it remains intact) 1. Capping 2. Tailing  Approximately 200 adenine ribonucleotides are added to the 3’ end  Called a poly A tail 3. Introns

15. Regents Biology mRNA modification  In eukaryotes, mRNA is modified prior to leaving the nucleus (ensuring it remains intact) 1. Capping 2. Tailing 3. Introns  Non coding regions  Removed before translation by spliceosomes so that only exons (coding regions) remain

16. Regents Biology mRNA modification  The modified mRNA strand now = mRNA transcript  Post transcriptional Editing Video Post transcriptional Editing Video

17. Regents Biology protein cytoplasm nucleus trait UCCCCCCAAUGUGAAAAAGGGGUU ribosome

18. Regents Biology How does mRNA code for proteins  mRNA leaves nucleus  mRNA goes to ribosomes in cytoplasm  Proteins built from instructions on mRNA aa How? mRNA UCCCCCCAAUGUGAAAAAGGGGUU

19. Regents Biology Translation  Occurs in the cytoplasm  3 stages 1. Initiation 2. Elongation 3. Termination

20. Regents Biology Translation 1. Initiation  An initiation complex is formed when the first tRNA is positioned on the ribosomal surface  Must be accurate or the reading frame will be inaccurate  This complex then binds to mRNA at the beginning of the gene  2 ribosomal subunits recognize the 5’ cap 2. Elongation 3. Termination

21. Regents Biology Translation  tRNA  A single stranded, Clover leaf shaped, Nucleic acid  Contains the anticodon (sequence of 3 bases) that recognizes the codon of mRNA  Each kind of tRNA carries a corresponding amino acid at its 3’ end

22. Regents Biology Translation 1. Initiation 2. Elongation  Code on mRNA is read in triplets (codons)  AUG (methionine) is the start codon in eukaryotes (fMET in prokaryotes)  Ribosomes have 2 sites for tRNA attachment A (acceptor) site and P (peptide) site  AUG enters the P site and is paired with the correct tRNA anticodon 3. Termination

23. Regents Biology Translation 1. Initiation 2. Elongation  Then the A site is filled with 2 nd codon and its complimentary tRNA anticodon  When their, aa are bonded, the ribosome moves along the mRNA strand in the 5’ to 3’ direction  The 2 nd codon and its tRNA moves to the P site and the 3 rd codon moves into the A site and is paired with its complementary tRNA, and so on  AUG is the only codon that begins in the P site  Released tRNA reunite with fresh aa from the cytoplasm 3. Termination

24. Regents Biology Translation 1. Initiation 2. Elongation 3. Termination  3 stop codons UGA, UAG, UAA have no complementary tRNA  Release factor (a protein) releases the polypeptide chain from the ribosome  Ribosomal subunits separate  Translation ends  Protein is folded and modified as necessary  Video (20 seconds) Video (20 seconds)

25. Regents Biology How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)? ribosome aa

26. Regents Biology Codon  Sequence of 3 adjacent nucleotides that code for 1 amino acid  Basic unit of genetic code aa mRNA UCCCCCCAAUGUGAAAAAGGGGUU

27. Regents Biology AUGCGUGUAAAUGCAUGCGCC mRNA mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ?  Codon = block of 3 mRNA bases codon ribosome

28. Regents Biology  For ALL life!  strongest support for a common origin for all life  Code has duplicates  several codons for each amino acid  mutation insurance!  Start codon  AUG  methionine  Stop codons  UGA, UAA, UAG The mRNA code

29. Regents Biology How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA anti-codon codon tRNA UAC Met GCA Arg CAU Val  Anti-codon = block of 3 tRNA bases amino acid TranslationTranslation Video

30. Regents Biology mRNA to protein = Translation  The working instructions  mRNA  The reader  ribosome  The transporter  transfer RNA (tRNA) mRNA UCCCCCCAAUGUGAAAAAGGGGUU aa tRNA GG U aa tRNA UAC aa tRNA GA C aa AGU ribosome

31. Regents Biology aa mRNA From gene to protein DNA transcription nucleus cytoplasm protein translation trait UCCCCCCAAUGUGAAAAAGGGGUU ribosome tRNA aa Video (3min)

32. Regents Biology Whoops! See what happens when your genes don’t work right! Any Questions??

33. Regents Biology Websites  Series of MANY protein synthesis Videos: Series of MANY protein synthesis Videos: