2. Introduction to Gene Expression Chapter 8 Sections 4 & 5

3. RNA Structure How is RNA different from DNA?

4. DNA (deoxyribonucleic acid) Contains the sugar DEOXYRibose ADENINEADENINE pairs with Thymine GUANINE pairs with Cytosine Double Stranded

5. RNA (ribonucleic acid) Contains the sugar Ribose adenine uraciladenine pairs with uracil GUANINE pairs with Cytosine Single Stranded

6. Is uracil a purine or a pyrimidine? How do you know? pyrimidine It has to be the same as thymine

7. Fill in Your Chart… Table 1. Differences Between DNA and RNA: DNARNA SUGAR DeoxyriboseRibose NITROGEN BASES A-T, G-CA-U, G-C SHAPE Double helixSingle strand

8. Let’s Practice: DNA Replication (Review) Strand 1 (old strand) Strand 2 (new strand) ATGCCAATATGCCAATTACGGTTA

9. RNA Synthesis (Transcription) DNA Template Strand RNA Sequence ATGCCAATATGCCAATUACGGUUA (Section 8.4)

10. Compare Strand 2 (the new strand you wrote the sequence for) in DNA Replication to the RNA sequence that resulted from RNA synthesis. What do you notice? The strands are identical except that in the RNA sequence resulting from transcription have uracil (U) instead of thymine (T)

11. Where in the cell does RNA synthesis occur? The nucleus What is RNA synthesis actually called? Transcription

12. What happens to the DNA molecule that was unzipped so that RNA synthesis (transcription) could occur? The double helix closed back up and it is still in the nucleus for use by the cell

13. Where does the RNA molecule that was just made go now? Into the cytoplasm How does it get out of the nucleus? Through a nuclear pore

14. Central Dogma: information flows in one direction from DNA to RNA to proteins

15. RNA Function: Why is RNA important? What are the three types of RNA? messenger RNA or mRNA, transfer RNA or tRNA, and ribosomal RNA or rRNA

16. Fill in the blanks to describe the function of each of the 3 types of RNA. Messenger RNA (mRNA) transcribes the code from DNA and takes it from the nucleus into the cytoplasm at the ribosome. Transfer RNA (tRNA) translates the message by transferring amino acids from the cytoplasm to the ribosomes based on the instructions in the mRNA. Ribosomal RNA (rRNA) is a structural component of ribosomes that binds mRNA and tRNA together (most RNA in a cell is rRNA).

17. RNA contains the message from the DNA that is needed by the cell to make proteins

18. Proteins: WHAT ARE PROTEINS? Proteins are organic compounds (compounds that contain carbon) that are made from amino acids (aa or AA) linked together by a type of covalent bond called a peptide bond. ex. AA 1 + AA 2 + AA 3 = a protein/polypeptide

19. WHY ARE PROTEINS IMPORTANT? help build cell organelles (found in the membranes)help build cell organelles (found in the membranes) are used as enzymes to promote reactionsare used as enzymes to promote reactions are found in muscles (actin & myosin), blood (hemoglobin), insulin, and antibodies, as well as hair, silk, and other body structures (skin, bones, ligaments, tendons, etc.)

20. How are proteins made? Proteins are made in the process of protein synthesis also called gene expression. There are two parts to this process: transcription and translation. These processes mainly occur in the G1 phase of Interphase in the Cell Cycle.

22. DNATransciption is when a molecule of DNA untwists and one strand is read to make a molecule of RNA. It occurs in the nucleus. Transcription: (Section 8.4)

23. Let’s “practice” transcription again. DNA 3’T A C G C T A G T C C G T C5’ mRNA 5’A U G C G A U C A G G C A G3’

24. Translation ( t RNA) Translation is when an mRNA molecule is “read” in the cytoplasm at a ribosome, and tRNA molecules bring amino acids in the order indicated by the nucleotide sequence of the mRNA molecule to be hooked together into a polypeptide (protein). (Section 8.5)

25. Here is a diagram showing translation. Write the number of the structure indicated in the diagram next to the correct name. amino acids anticodon mRNA polypeptide Ribosome 14325

26. Let’s practice translating a message Start by transcribing the DNA sequence given into a molecule of mRNA. Divide the mRNA into codons by drawing a line between every 3 nucleotides in the mRNA code. Then, write the anticodons that would be found on the corresponding tRNA molecule. Finally, use the codon chart to determine which amino acid is coded for by the sequence in the mRNA.

27. Codons in mRNA

28. DNA Sequence: T A C G G G T T C A A C T T G A C T A U G C C C A A G U U G A A C U G A (codons) U A C G G G U U C A A C U U G A C U (anticodons) Start/met pro lys leu asp stop Sequence: How many codons did you write? ____ How many anticodons did you write? How many anticodons did you write? ____ How many amino acids were coded for? (HINT: Stop is NOT an amino acid) ____ 6 6 5 tRNA Sequence: mRNA Sequence: Amino Acid

29. Overview of Protein Synthesis (Gene Expression) What are the structures labeled 1 & 2? 1. Nucleus or nuclear envelope & 2. cytoplasm 2

30. This diagram shows only 1 ribosome translating the message from the mRNA into the polypeptide (amino acid sequence). Is this accurate? Explain. Hundreds of ribosomes translate the mRNA at the same time so that there is time for the process to finish 2 No

31. 2

32. 2

33. If red flowers are RR or Rr and white flowers are rr, explain why these two alleles are EXPRESSED differently. The R allele codes for a protein that is a red pigment while the r allele does not code for the synthesis of any molecule 2

34. On the lines in this box, write WHERE in the cell each process occurs. Be specific. _________________ _________________ _________________ ______________________ ______________________ ______________________

35. On the lines in this box, write WHERE in the cell each process occurs. Be specific. _________________ ___ nucleus ______ _________________ ______________________ ____ cytoplasm at a__ _____ribosome ______