1. Thatiane Lima Sampaio thati_sampaio@yahoo.com.br HIV-1 production is dependent on the incorporation of Dynamin-2 by Nef

2. HIV-1 PRODUCTION IS DEPENDENT ON THE INCORPORATION OF D YNAMIN -2 BY N EF Thatiane Lima Sampaio 1,2 ; Boris Matija Peterlin 3, Sônia Nair Báo 1 1 University of Brasilia, DF 70910-900, Brazil. 2 Federal Institute of Brasilia, DF 70830-450, Brazil. 3 University of California, San Francisco, CA 94122, USA. Atlanta, April 2015 e-mail: thati_sampaio@yahoo.com.br

5. Lentivirus virus particles structure http://www.brookscole.com Introduction

6. HIV genomic organization Introduction

7. SLIP region in RNAm de gag e pol PAULUS et al., 2004 http:// www.lookfordiagnosis.com/mesh_info.php?term=Fusion+Proteins%2C+Gag- Pol&lang=1 Introduction

8. Viral Protease (LEE et al., 2012) Introduction

9. Structure Molecular Model of Negative Factor (NEF) Nef is a crucial factor for virion infectivity and HIV-1 and SIVmac pathogenesis. 27-35 kDa. Introduction

10. Role of Nef in primate lentiviral immunopathogenesis Kirchhoff, F. Cell. Mol. Life Sci. 65 (2008) 2621 – 2636 Introduction

11. Jurkart Cells Introduction

12. Jurkart Cells

13. OBJECTIVE To investigate the effects of the interaction between Dynamin-2 and Nef during HIV-1 production

14. M ATHERIALS Antibodies: Primaries: anti-CA (NIH #1238), anti-RT (NIH #6195), anti-IN (#757), anti-Nef (NIH #2949), anti- Clatrina HC (Santa Cruz Biotechnology), anti-Dinamia 2 (Sigma Aldrich), anti-GFP (Sigma Aldrich). Células: Células Hek-293T e TZM-bl in DMEN (Sigma Aldrich). RNAs de interferência (siRNA): for clathrin HC (AACCUGCGGUCUGGAGUCAAC) (Hinrichsen et al., 2003), for dynamin 2 (GACAUGAUCCUGCAGUUCA) (Pizzato et al., 2011), control ( non- target #1) (Dharmacon).

15. Methods Transient transfection in 293T cells

16. Iodixanol Gradient Methods 0 1 2 3 4 5 6 7 8 9 10 11 HIV-1 WT + DNM2.GFP CA B Top Bottom Before After

17. + ++ + + + 1 2 3 4 5 6 The overexpression of Dynamin-2 allows for the enhancement of infectivity of HIV-1 wild type, but is not able to rescue HIV-1 Nef-deficient infectivity HIV-1 ΔNef HIV-1 WT Dinamin 2.GFP Dinamin 2.K44A.GFP + + + + GFP vector + + Dinamin 2.GFP Dinamin 2.K44A.GFP GFP vector A %Razão CA/Gag B C D VLP 1 2 3 4 5 6 HIV-1 ΔNef HIV-1 WT Fig. 1 1 2 3 4 5 6 HIV-1 ΔNefHIV-1 WT HIV-1 ΔNefHIV-1 WT Results 1 2 3 4 5 6

18. Figure 1B. Clatrin HC and Dynamin 2 knockdown decrease HIV-1 wt and HIV-1 Δnef infectivity. (C) The siRNA-mediated depletion of clathrin HC and dynamin 2 in virus-producing 293T cells decreases the infectivity of nef –positive and nef- negative progeny virus. (D) The virus production level are equivalent during knockdown of HIV-1 wt and HIV-1ΔNef, except for lane 8. The siRNA assay follow the order (1 and 5) siRNA non-target, (2 and 6) siRNA Clathin HC, (3 and 7) siRNA Dynamin 2, (4 and 8) siRNA Dynamin 2 + siRNA Clathrin HC. Infectivities are the means of triplicate determinations of one experiment. Clathrin HC and Dynamin 2 knockdown turned HIV-1 WT become as infectious as HIV-1ΔNef, while HIV-1ΔNef knockdown or double knockdown decreased significantly the viral infectivity. Infectivity ELISA p24 A B HIV-1WT HIV- 1ΔNef 1 2 3 4 5 6 7 8 Fig. 2 WB: αClathrin LC C siRNA Clathrin LC +- Clathrin LC Results

19. 250 150 100 50 75 250 50 75 Dynamin 2 cleavage product is less incorporated in HIV-1 Δnef than in HIV-1 WT Dinamin 2 Fig. 3. Purification of HIV-1 particles using a Optiprep TM gradient. HIV-1 WT and ΔNef were produced by transient transfection in human embryonic kidney 293T cells and purified as described in Materials and methods. The 100,000 x g HIV-1 pellet was overlaid on the Optiprep gradient. Western blotting of HIV-1 WT and HIV-1 ΔNef pellets using anti-dynamin2. Optiprep fractions assay 3 Fig. 3 Results 0 1 2 3 4 5 6 7 8 9 10 11 WB: αDinamin 2 0 1 2 3 4 5 6 7 8 9 10 11 HIV-1 Δnef + DNM2.GFP HIV-1 WT + DNM2.GFP WB: α-CA CA Top Bottom HIV-1 Δnef + DNM2.GFP HIV-1 WT + DNM2.GFP

20. Discussion

21. Dynamin 2 is expressed more in T cell lines than in other cells The Dynamin 2 expression level on different cells lines should explain the difference of dynamin knockdown in Jukart cells (Pizzato) compared to the results for 293T. Results Dnm 2 100 Β-actina Molt 4 Jurkart HeLa HeLa CIITA TZM-bl 293T Ratio β-actina/Dnm2

22. Discussion

23. Molt 4 Jurkart More Dynamin 2 293T Less Dynamin 2 WT and ΔNef infectivity difference is 40X. WT and ΔNef infectivity difference is 2-4X. Pizzato et al., 2007Sampaio et al., 2015 Model for cell type infectivity difference

24. C ONCLUSIONS This data suggests that Nef and Dynamin-2 interaction is an important factor for virus infectivity and production

25. Acknowledgments Profa. Dra. Sônia Nair Báo Dr. Boris Matija Peterlin e-mail: thati_sampaio@yahoo.com.br