1. CASIROZ Fall Meeting Antwerp 2003 Participant group 2 W. Oßwald Manuela C. Blumenröther Forest Phytopathology, TU Munich

2. Objectives/Achievements 2003 b) Gene expression studies for Rubisco and PEPC RNA extraction, primer design for Rubisco, RT-PCR a) Enzyme activity measurements for Rubisco and PEPC Method learned at INRA, Nancy (Prof. Dizengremel) and established in the lab

3. Primer design for Rubisco, small subunit

4. Rubisco Exon1 1 TATGGCTTCCTCTATGATTTCCTCGGCCACTGTTGCCACCGTTAGCCGAGCCACCCCGGCTCACGCTACCATGGTTGCAC 80 Rubisco Exon2 1 -------------------------------------------------------------------------------- 1 Rubisco Exon3 1 -------------------------------------------------------------------------------- 1 2Rubisco su FW 1 -------------------------------------------------------------------------------- 1 2Rubisco su RV (RC) 1 -------------------------------------------------------------------------------- 1 Rubisco Exon1 81 CATTCACTGGTCTCAAGTCTACTGCAGCTTTCCCAGCTACCCAAAAGAGCAACAATGACATTACCTCTCTTGCAAGCAAT 160 Rubisco Exon2 1 -------------------------------------------------------------------------------- 1 Rubisco Exon3 1 -------------------------------------------------------------------------------- 1 2Rubisco su FW 1 -------------------------------------------------------------------------------- 1 2Rubisco su RV (RC) 1 -------------------------------------------------------------------------------- 1 Rubisco Exon1 161 GGTGGAAGAGTGCAATGCATGAAGGT 186 Rubisco Exon2 1 --------------------------GTGGCCACCACTTGGTTTGCAGAAGTTTGAGACTCTTTCCTACCTTCCACCACT 54 Rubisco Exon3 1 -------------------------------------------------------------------------------- 1 2Rubisco su FW 1 -----------------CATGAAGGTGTGGCCACCACTT 22 2Rubisco su RV (RC) 1 -------------------------------------------------------------------------------- 1 Rubisco Exon1 186 186 Rubisco Exon2 55 TTCTCTCGAGTCATTGGCTAAGCAAATTGAATACCTTATTTTGAAGGGATGGATTCCTTGCTTGGAATTCGAGCTGGAG 133 Rubisco Exon3 1 -------------------------------------------------------------------------------C 1 2Rubisco su FW 22 22 2Rubisco su RV (RC) 1 ----------------------------------------------------------------------GAGCTGGAGC 10 Rubisco Exon1 186 186 Rubisco Exon2 133 133 Rubisco Exon3 2 ACCCCTTTGTGTACCGTGAGAACAACAGGTCACCAGGGTACTATGATGGACGTTACTGGGTGATGTGGAAGCTGCCCATG 81 2Rubisco su FW 22 22 2Rubisco su RV (RC) 11 ACCCCTTTGTG 21 Rubisco Exon1 186 186 Rubisco Exon2 133 133 Rubisco Exon3 82 TTTGGATGCACCGATGCCACACAGGTGTTGGCGGAGCTCCAGGGGGCCAGTAAGACTTATCCCACTTCCCACATCCGAAT 161 2Rubisco su FW 22 22 2Rubisco su RV (RC) 21 21 Rubisco Exon1 186 186 Rubisco Exon2 133 133 Rubisco Exon3 162 CATCGGATTCGACAACAAGCGTCAAGTGCAGTGCATCAGTTTCATTGCTTACA 214 2Rubisco su FW 22 22 2Rubisco su RV (RC) 21 21

5. Objectives/Achievements 2003 b) Gene expression studies for Rubisco and PEPC RNA extraction, primer design for Rubisco, RT-PCR a) Enzyme activity measurements for Rubisco and PEPC c) Analysis of the carbohydrate content Method learned at INRA, Nancy (Prof. Dizengremel) and established in the lab Methods established, first results for May and June samples su Rubisco + Std. -

6. Sampling-Timetable 50 leaves, all cut in 3 pieces 100 leaves per date, all cut in 3 pieces 50 leaves per time point, all cut in 2 pieces Σ 150 single samples Σ 1200 single samples Σ 300 single samples June/July/Sept./Oct.: 10 trees, sun & shade crown July: 10 trees, sun crown, 3 additional time points for diurnal assessment May: 10 trees, only sun crown

7. Variation within the sample branches Extraction routine is reliable, differences between single samples are tree/branch specific

8. Sugar and starch content in May and June leaf samples of adult trees Ozone sensitivity in carbohydrate and starch metabolism visible

9. Carbohydrate contents for sun leaves on the single tree level (June 2003) 2 x O3 1 x O3 2 x O3 1 x O3 Is ozone affecting sugar allocation?

10. ...high in the sky... - what about the variation within a canopy? Sampling for canopy variation assessment (July, 16.) Sun crown of tree no. 399 devided in 4 segments (N, E, S, W), 3 branches marked per segment, 5 leaves per branch collected and cut into 2 halves for enzyme & carbohydrate experiments. N W S E

11. Carbohydrate variation within the canopy of 399 N S Indeed there is variation within the canopy!

12. In addition... October, 13.: in contrast to Oct., 07. leaf sampling at sunny weather; August, 11.: leaf sampling in parallel with gas exchange measurements under saturating light conditions; Leaf samples from: young trees branch cuvette fumigation chambers 10 trees, 50 leaves, (only carbohydrate and enzyme experiments) two trees 1 x O3, two trees 2 x O3; sun & shade crown positions, 80 leaves (only carbohydrate and enzyme experiments)

13. Preview for 2004 No major changes in sampling time schedule Primer design for PEPC Continuing carbohydrate and enzyme activity measurements Including young tree and cuvette leaf samples