Presentation is loading. Please wait.

Presentation is loading. Please wait.

Supplemental Figure S1 ResidueMass Delta Mass Sequence Mascot Ion Score 62 - 701064.640.04R.DFGLLVFVR.K49 125 - 133994.680.04K.IPALDLLIK.L56 156 - 163939.550.04K.FYGELALK.K34.

Published byBernard Atkins Modified over 9 years ago

Similar presentations

Presentation on theme: "Supplemental Figure S1 ResidueMass Delta Mass Sequence Mascot Ion Score 62 - 701064.640.04R.DFGLLVFVR.K49 125 - 133994.680.04K.IPALDLLIK.L56 156 - 163939.550.04K.FYGELALK.K34."— Presentation transcript:

1 Supplemental Figure S1 ResidueMass Delta Mass Sequence Mascot Ion Score 62 - 701064.640.04R.DFGLLVFVR.K49 125 - 133994.680.04K.IPALDLLIK.L56 156 - 163939.550.04K.FYGELALK.K34 311 - 3211148.690.04K.AALSALESFLK.Q59 526 - 532926.480.03K.DYVDLFR.H39 660 - 6681036.640.04R.LPLISGFYK.L58 811 - 8201174.620.04K.NNWEVSALSR.A43 839 - 8521573.870.08K.NLSSNEAISLEEIR.I117 892 - 899935.560.04R.LSFAVPFR.E38 914 - 9241174.670.06R.VTELALTASDR.Q86 965 - 971844.550.03R.TFPVLLR.L30 1000 - 10262943.640.10K.KFESQDTVALLEAILDGIVDPVDSTLR.D50 1063 - 10741372.810.06R.LYSLALHPNAFK.R57 1076 - 10871337.770.06R.LGASLAFNNIYR.E72 1194 - 12021011.630.04K.FVPLLPGNR.S34 1275 - 12921814.080.07R.TVGALQVLGTEAQSSLLK.A79 1618 - 16271209.740.05K.LATTILQHWK.K66 1690 - 17112335.330.09K.GQAVTLLPFFTSLTGGSLEELR.R32 1690 - 17122491.430.09K.GQAVTLLPFFTSLTGGSLEELRR.V57 1838 - 18521694.980.06R.EFFSTIVVDAIDVLK.S70 1858 - 18691395.750.06K.LNESTFDTQITK.K75 1974 - 19851443.890.06K.NLLIFENLIDLK.R68 1974 - 19861600.020.08K.NLLIFENLIDLKR.R37 2133 - 21431204.780.05K.LGNPIVPLNIR.L67 2149 - 21621677.980.07K.LVINTEEVFRPYAK.H49 2312 - 23281878.150.09R.YKEVYAAAAEVLGLILR.Y52 2314 - 23281586.950.05K.EVYAAAAEVLGLILR.Y119 2486 - 25001752.810.08R.DPESETDNDSQEIFK.L77 2777 - 27861134.660.05R.HGDLPDIQIK.H58 2787 - 28001519.910.06K.HSSLITPLQAVAQR.D62 2807 - 28181338.810.05K.QLFSSLFSGILK.E65 2892 - 2899955.610.04R.LLEEALLR.L59 3051 - 30671903.120.09K.LLLQGEADQSLLTFIDK.A91 3129 - 31472180.280.11K.LQSVQALTEIQEFISFISK.Q57 3325 - 33351292.730.06R.DQNILLGTTYR.I54 3697 - 37081389.720.06R.NELEIPGQYDGR.G58 3800 - 38131627.990.08R.LGLIEWLENTVTLK.D71 IgG Snail1-Flag DNA-PKcs Snail1-Flag IgGCon

2 DNA-PKcs Non-neoplasticCase 1Case 2Case 3Case 4Case 5 Snail1 DNA-PKcs Snail1 Human colon cancer Adenocarcinoma Squamouse cell carcinoma DNA-PKcs Snail1 Human lung cancer Supplemental Fig. S2

3 Snail1 GenBank: AF131208.1 1 atgccgcgctctttcctcgtcaggaagccctccgaccccaatcggaagcctaactacagc M P R S F L V R K P S D P N R K P N Y S 61 gagctgcaggactctaatccagagtttaccttccagcagccctacgaccaggcccacctg E L Q D S N P E F T F Q Q P Y D Q A H L 121 ctggcagccatcccacctccggagatcctcaaccccaccgcctcgctgccaatgctcatc L A A I P P P E I L N P T A S L P M L I 181 tgggactctgtcctggcgccccaagcccagccaattgcctgggcctcccttcggctccag W D S V L A P Q A Q P I A W A S L R L Q 241 gagagtcccagggtggcagagctgacctccctgtcagatgaggacagtgggaaaggctcc E S P R V A E L T S L S D E D S G K G S(100) 301 cagccccccagcccaccctcaccggctccttcgtccttctcctctacttcagtctcttcc Q P P S P P S P A P S S F S S T S V S S 361 ttggaggccgaggcctatgctgccttcccaggcttgggccaagtgcccaagcagctggcc L E A E A Y A A F P G L G Q V P K Q L A 421 cagctctctgaggccaaggatctccaggctcgaaaggcctccaactgcaaatactgcaac Q L S E A K D L Q A R K A S N C K Y C N 481 aaggaatacctcagcctgggggcgctgaagatgcac K E Y L S L G A L K M H Supplemental Fig. S3

4 a b Normal controlCT26 cellsCT26-WTCT26-S100ACT26-S100D H&E Supplemental Fig. S4 ConWT S100A S100D Normal 2.5 2 1.5 1 0.5 0 Con WT S100A S100D Normal Lung weight (%) CT26 * 0.40.60.811.2 S100A S100D WT Con A549 E-cadherin promoter activity Snail1 * * Con WT S100A S100D Snail1 β -Actin Snail1 Migration activity (Fold increase) Con WT S100A S100D Snail1 0510 * * A549

5 a c S104A/S107AWTS100A p-p53 (Ser15) p53 γ-H2AX Snail1 β-Actin 010306001030600103060 Snail-Flag (IR, min)  -Actin Snail1 p-p53 (Ser15) p53  -H2AX NCI-H460 Snail1Con NCI-H460 SCSnail1siRNA : (IR, min) 0103060 010306001030600103060 b NCI-H460 β-Actin Snail1 A549 WTS100A S104A / S107A pCR3.1 Snail1-Flag WT S100A S104A / S107A pCR3.1 Snail1-Flag pCR3.1 WT S100A S104A-107A 0 0.5 1 3 H460A549 - +++ - +++ Snail1 DNA-PK kinase activity (Fold increase) Supplemental Fig. S5

6 b M059J Death(%) 0 20 40 60 80 100 ConSnail1 Death(%) 0 10 20 30 40 50 60 -+-+ Si-Snail1 * * G2/M phase (%) M059J c DLD-1 Snail1 Snail1/shDNA-PKcs 4500 4000 3500 3000 2500 2000 1500 1000 500 01419262933 (day) * * * * * Supplemental Fig. S6 p-GSK3β (Tyr216) DNA-PKcs β-Actin p-DNA-PKcs (Ser2056) GSK3β 01090120(IR, min)3060 d a

Download ppt "Supplemental Figure S1 ResidueMass Delta Mass Sequence Mascot Ion Score 62 - 701064.640.04R.DFGLLVFVR.K49 125 - 133994.680.04K.IPALDLLIK.L56 156 - 163939.550.04K.FYGELALK.K34."

Similar presentations

Supplemental Figure 1 A No. at risk T3 530 483 304 185 50 T2 559 545 373 228 76 T1 540 532 375 208 64.

Supplemental Figure 1 A No. at risk T T T
Figure 1.1 The observer in the truck sees the ball move in a vertical path when thrown upward. (b) The Earth observer views the path of the ball as a parabola.

Figure 1.1 The observer in the truck sees the ball move in a vertical path when thrown upward. (b) The Earth observer views the path of the ball as a parabola.
Supplementary Figure 1. DAXX S564A does not change Mdm2/p53 stability or p53 ‑ mediated gene expression. (A) U2OS cells stably transduced with pCDH-DAXX.

Supplementary Figure 1. DAXX S564A does not change Mdm2/p53 stability or p53 ‑ mediated gene expression. (A) U2OS cells stably transduced with pCDH-DAXX.
(+++) Normal breast ATM (++) IDC ATM Lymph node metastasis negative positive P-value - + ++ +++ 35 32 27 16 36 73 50 27 0.085 A B X200 C Vector ATM - WT.

(+++) Normal breast ATM (++) IDC ATM Lymph node metastasis negative positive P-value A B X200 C Vector ATM - WT.
WT KO A B Suppl. Fig 1 Supplemental Figure 1. The expression of CYLD in liver. (A) Immunohistochemical analysis of CYLD in liver tissue of adult wildtype.

WT KO A B Suppl. Fig 1 Supplemental Figure 1. The expression of CYLD in liver. (A) Immunohistochemical analysis of CYLD in liver tissue of adult wildtype.
Fig. 1 (A) (B) (C) * * * * Mock siRNA siRNA Day 3 Day 8 1 2 3 4 DNA-PKcs Beta actin.

Fig. 1 (A) (B) (C) * * * * Mock siRNA siRNA Day 3 Day DNA-PKcs Beta actin.
Supplementary Figure Legends: Table 1. List of primers used for Real Time – PCR Supp Fig 1. S100A7-overexpressing MCF7 cells show decreased formation of.

Supplementary Figure Legends: Table 1. List of primers used for Real Time – PCR Supp Fig 1. S100A7-overexpressing MCF7 cells show decreased formation of.
Figure S1 Figure S1. (A) Screen of USPs for regulating c-Myc stability. Scores of c-Myc protein abundence was derived from two independent experiments.

Figure S1 Figure S1. (A) Screen of USPs for regulating c-Myc stability. Scores of c-Myc protein abundence was derived from two independent experiments.
Supplementary Figure 2: Representative Kaplan-Meier plots of overall survival considering alterations erbB signaling pathway genes and p53 in lung cancer.

Supplementary Figure 2: Representative Kaplan-Meier plots of overall survival considering alterations erbB signaling pathway genes and p53 in lung cancer.
Kami, et al. Supplementary Fig. S2A. Kami, et al. Supplementary Fig. S2B.

Kami, et al. Supplementary Fig. S2A. Kami, et al. Supplementary Fig. S2B.
Supplemental Figure 1 Expression of UHRF1 detected by TaqMan qRT-PCR and many characteristics of patients were compared by Mann-Whiteney’s U-test. A. Expression.

Supplemental Figure 1 Expression of UHRF1 detected by TaqMan qRT-PCR and many characteristics of patients were compared by Mann-Whiteney’s U-test. A. Expression.
Date of download: 6/22/2016 Copyright © 2016 American Medical Association. All rights reserved. From: Reduction of Hyaluronan-CD44–Mediated Growth, Migration,

Date of download: 6/22/2016 Copyright © 2016 American Medical Association. All rights reserved. From: Reduction of Hyaluronan-CD44–Mediated Growth, Migration,
Shimura Supplemental Figure 1

Shimura Supplemental Figure 1
Main Figures and Tables

Main Figures and Tables
Src-Family Kinases Are Activated in Non-Small Cell Lung Cancer and Promote the Survival of Epidermal Growth Factor Receptor-Dependent Cell Lines  Jie.

Src-Family Kinases Are Activated in Non-Small Cell Lung Cancer and Promote the Survival of Epidermal Growth Factor Receptor-Dependent Cell Lines  Jie.
Supplementary Figure 1. Importance of first neighbours in breast cancer, hepatocellular carcinoma and non-small cell lung cancer in the SignaLink network.

Supplementary Figure 1. Importance of first neighbours in breast cancer, hepatocellular carcinoma and non-small cell lung cancer in the SignaLink network.
Figure 3. CRTC1 directly regulates COX-2 and predicts a positive feedback loop deregulated following LKB1 loss. A) Protein immunoblot showing fold induction.

Figure 3. CRTC1 directly regulates COX-2 and predicts a positive feedback loop deregulated following LKB1 loss. A) Protein immunoblot showing fold induction.
Aldehyde Dehydrogenase 1A1 Possesses Stem-Like Properties and Predicts Lung Cancer Patient Outcome  Xiao Li, MD, Liyan Wan, MD, Jian Geng, MD, Chin-Lee.

Aldehyde Dehydrogenase 1A1 Possesses Stem-Like Properties and Predicts Lung Cancer Patient Outcome  Xiao Li, MD, Liyan Wan, MD, Jian Geng, MD, Chin-Lee.
From: Overexpression of the μ-Opioid Receptor in Human Non-Small Cell Lung Cancer Promotes Akt and mTOR Activation, Tumor Growth, and Metastasis Anesthes.

From: Overexpression of the μ-Opioid Receptor in Human Non-Small Cell Lung Cancer Promotes Akt and mTOR Activation, Tumor Growth, and Metastasis Anesthes.
Supplemental Digital Content 4

Supplemental Digital Content 4

Similar presentations

Ads by Google