Download presentation
Presentation is loading. Please wait.
Published bySuzanna Whitehead Modified over 8 years ago
1
Phylogenetic analysis of flatfish species (Teleostei, Pleuronectiformes) based on cytochrome oxidase 1 (Co-1) and cytochrome b (Cyt-b) genes Sharina S.N., Kartavtsev Y.P.
2
The phylogenetic relationships within the order are still problematic Fish mitochondrial DNA is now widely used with phylogenetic purposes Most popular in phylogenetics are sequences of cytochrome b (Cyt-b) and cytochrome oxidase 1 (Cо-1) genes, which used for taxa comparison at the species- family level. INTRODUCTION
3
Aim: Molecular phylogenetic investigation of relationships among order Pleuronectiformes To make reconstruction the phylogenetic relationships based on Co-1 and Cyt-b gene sequencing among some flatfish species were made. To confirm or disprove the monophyly of the flatfish family Pleuronectidae and genus Pleuronectes several tree types were built.
4
Materials and methods S amples of the collection Kievka Bay Vostok Bay
5
Flatfish-1-F TCTTTAGATTTGCAATCTAACATGTA Flatfish-1-R GTCAGTAGCATTGTAATTCCTGCGGC Flatfish-2-F TGGGCCCATCACATATTTACAGTCGG Flatfish-2-R CAGAGCGGTTATGTGGTTGGCTTGAA (~1500 bp) (Kartavtsev et al., 2007) Flatfish-cytb-F – ATGGCCAACCTCCGTAAATCCCACCCCCTTC Flatfish-cytb-R – CTGGGGCTCTGGACGCTGAGCTACTAGTGC (~1441 bp) 20 spesies of Pleuronectiformes for Co-1 gene 47 species of Pleuronectiformes for Cyt-b gene 2 species of Gadiformes as outgroup
6
Rooted consensus (50%) MP-tree showing phylogenetic interrelationships on the basis of Co-1 sequence data. In the nodes bootstrap support (n=1000) for MP and NJ (MP/NJ) are shown. The tree was rooted with the sequences of two out-group species: Gadiformes. Rooted consensus (50%) MP-tree showing phylogenetic interrelationships on the basis of Co-1 sequence data. In the nodes bootstrap support (n=1000) for MP and NJ (MP/NJ) are shown. The tree was rooted with the sequences of two out-group species: Gadiformes.
7
Rooted consensus (50%) BA-tree showing phylogenetic interrelationships on the basis of Cyt-b sequence data. In the nodes bootstrap support (n=1000) for NJ and MP and repetition frequencies for n=10 6 simulated generations for BA (BA/MP/NJ) are shown. The tree was built based on the TrN+I+G model and was rooted with the sequences of two out-group species: Gadiformes. Rooted consensus (50%) BA-tree showing phylogenetic interrelationships on the basis of Cyt-b sequence data. In the nodes bootstrap support (n=1000) for NJ and MP and repetition frequencies for n=10 6 simulated generations for BA (BA/MP/NJ) are shown. The tree was built based on the TrN+I+G model and was rooted with the sequences of two out-group species: Gadiformes.
8
Hippoglossinae Hippoglossoidinae Pleuronectinae
9
Conclusions: Family Pleuronectidae with high confidence may be considered as monophyletic. According the last systematical revision, we have sampled in the genus Pleuronectes only one species P. pinnifasciatus. Other species, placed in different genera Pseudopleuronectes, Liopsetta, and Lepidopsetta. The diagnostics of species (barcoding) based on Co-1 and Cyt- b gene sequences is highly effective because of low intraspecies and high interspecies variability of this markers.
10
THANKS FOR ATTENTION!
Similar presentations
© 2024 SlidePlayer.com. Inc.
All rights reserved.