1. Phylogenetic analysis of flatfish species (Teleostei, Pleuronectiformes) based on cytochrome oxidase 1 (Co-1) and cytochrome b (Cyt-b) genes Sharina S.N., Kartavtsev Y.P.

2.  The phylogenetic relationships within the order are still problematic  Fish mitochondrial DNA is now widely used with phylogenetic purposes  Most popular in phylogenetics are sequences of cytochrome b (Cyt-b) and cytochrome oxidase 1 (Cо-1) genes, which used for taxa comparison at the species- family level. INTRODUCTION

3. Aim: Molecular phylogenetic investigation of relationships among order Pleuronectiformes  To make reconstruction the phylogenetic relationships based on Co-1 and Cyt-b gene sequencing among some flatfish species were made.  To confirm or disprove the monophyly of the flatfish family Pleuronectidae and genus Pleuronectes several tree types were built.

4. Materials and methods S amples of the collection Kievka Bay Vostok Bay

5.  Flatfish-1-F TCTTTAGATTTGCAATCTAACATGTA  Flatfish-1-R GTCAGTAGCATTGTAATTCCTGCGGC  Flatfish-2-F TGGGCCCATCACATATTTACAGTCGG  Flatfish-2-R CAGAGCGGTTATGTGGTTGGCTTGAA (~1500 bp) (Kartavtsev et al., 2007)  Flatfish-cytb-F – ATGGCCAACCTCCGTAAATCCCACCCCCTTC  Flatfish-cytb-R – CTGGGGCTCTGGACGCTGAGCTACTAGTGC (~1441 bp) 20 spesies of Pleuronectiformes for Co-1 gene 47 species of Pleuronectiformes for Cyt-b gene 2 species of Gadiformes as outgroup

6. Rooted consensus (50%) MP-tree showing phylogenetic interrelationships on the basis of Co-1 sequence data. In the nodes bootstrap support (n=1000) for MP and NJ (MP/NJ) are shown. The tree was rooted with the sequences of two out-group species: Gadiformes. Rooted consensus (50%) MP-tree showing phylogenetic interrelationships on the basis of Co-1 sequence data. In the nodes bootstrap support (n=1000) for MP and NJ (MP/NJ) are shown. The tree was rooted with the sequences of two out-group species: Gadiformes.

7. Rooted consensus (50%) BA-tree showing phylogenetic interrelationships on the basis of Cyt-b sequence data. In the nodes bootstrap support (n=1000) for NJ and MP and repetition frequencies for n=10 6 simulated generations for BA (BA/MP/NJ) are shown. The tree was built based on the TrN+I+G model and was rooted with the sequences of two out-group species: Gadiformes. Rooted consensus (50%) BA-tree showing phylogenetic interrelationships on the basis of Cyt-b sequence data. In the nodes bootstrap support (n=1000) for NJ and MP and repetition frequencies for n=10 6 simulated generations for BA (BA/MP/NJ) are shown. The tree was built based on the TrN+I+G model and was rooted with the sequences of two out-group species: Gadiformes.

8. Hippoglossinae Hippoglossoidinae Pleuronectinae

9. Conclusions:  Family Pleuronectidae with high confidence may be considered as monophyletic.  According the last systematical revision, we have sampled in the genus Pleuronectes only one species P. pinnifasciatus. Other species, placed in different genera Pseudopleuronectes, Liopsetta, and Lepidopsetta.  The diagnostics of species (barcoding) based on Co-1 and Cyt- b gene sequences is highly effective because of low intraspecies and high interspecies variability of this markers.

10. THANKS FOR ATTENTION!