Download presentation
Presentation is loading. Please wait.
Published byDominic Wheeler Modified over 8 years ago
1
Supplementary Table 1 Summery of the case-control association analysis of representative SNPs around ITPR3 locus MAF, minor allele frequency. CI, confidence interval
4
SLE, Systemic lupuserythematosusRA,Rhematoidarthritis. CI, confidence interval. n, number of individuals. a Oddsratio and p -value were calculatedon dominant model(TT + CT versus CC). Supplementary Table 4 Association of the SNP(1192C>T) of NKX2.5 with SLE and RA Genotype DiseasenTTCTCCAllele T frequency Odds ratio a (95%c.i.) p-value SLE1743381330.131.74 (1.19-2.55)0.0037 RA1115121899140.101.24 (1.01-1.54)0.042 Control14151020412110.08
6
Amplified region a Forward primerReverse primer -1015 to -999 Allele C TandemTGGGCACCCTATCTTAGGTGGGCACCCTATCTTAGGTACCTAAGATAGGGTGCCCACCTAAGATAGGGTGCCCA -1015 to -999 Allele T TandemTGGGCACTCTATCTTAGGTGGGCACTCTATCTTAGGTACCTAAGATAGAGTGCCCACCTAAGATAGAGTGCCCA ProbeSenseAntisense -1015/-999 Allele CGGGCACCCTATCTTAGGCCTAAGATAGGGTGCCC -1015/-999 Allele TGGGCACTCTATCTTAGGCCTAAGATAGAGTGCCC NKX2.5 consensusCTGACCTCAAGTGATCTACCGGTAGATCACTTGAGGTCAG Amplified region a Forward primerReverse primer -1153 to -930CCCCTAGCCTCTCTTCTTCCGGGCTCGCTTACTTTCTGTTC IVS6 +229 to +346AAGACACCCTGTCCTTGTGCTGCGGAAGGGTGACAAGAC Target geneForward primerReverse primer ITPR3 CCACCATGAAGCTGGTGTCTGATGAGCATCCCCTGTTG ß2MG TCTCTCTTTCTGGCCTGGAGAATGTCGGATGGATGAAACC HPRT CACTGGCAAAACAATGCAGACTGTCTGGCTTATATCCAACACTTCGT a: Based on the reference sequence NCBI NT_007592.14 Primers used for quantification of target genes Primers used for CHIP assay Oligonucleotides used for EMSA Primers used for constructing reporter plasmids Supplementary Table 6 Sequences of oligonucleotides
Similar presentations
© 2024 SlidePlayer.com. Inc.
All rights reserved.