1. Genetics …in the news.

2. Mutations …are heritable changes in base sequences that modify the information content of DNA.

3. Wild-type Alleles two definitions General: any allele existing at a frequency greater than 1% in a natural population, Experimental Geneticist: the one allele that dictates the most commonly found phenotype in a population. Forward mutation: any change that changes a wild- type allele to a different allele… A + --> a recessive mutation b + --> B dominant mutation a --> A +, B --> b + reversions Reverse mutations: novel mutant alleles can revert back to wild-type…

5. Mutant Classifications …by their effect on DNA Substitutions

6. Mutagenic Agents Base Analogs Alkylating Agents Intercalating Agents Deaminating Agents

7. To Know

8. Mutant Classifications …by their effect on DNA deletions and insertions i d 1 base? 2 base? 3 base? etc.

9. Frameshifts

10. Mutant Classifications …by their effect on DNA inversions translocations

11. Trinucleotide Repeat Expansions FMR1 Fragile X Mental Retardation 1 cgg...GCGCGGCGGTGACGGAGGCGCCGC TGCCAGGGGGCGTGCGGCAGCG... …CTGGGCCTCGAAGCGCCCGCAGCCA cgg... > 230

14. Ames Test testing for mutagenicity More mutagenic? Barbecue beef Iceberg Lettuce Cold Beer

15. 5’ 3’ 5’ 3’5’ N- -C enhancer, silencer, core promoter? ?? ?? ? AAUAAA

16. Transposable Elements …a segment of DNA that can move to, or move a copy of itself to another locus on the same or a different chromosome (hopping DNA), …may be a single insertion sequence, or a more complex structure (transposon) consisting of two insertion sequences and one or more intervening genes.

17. Inverted repeats. Transcribed genes. Transposable Elements

18. Transposition normal gene, normal RNA, normal protein, transposon inserted in gene, abnormal RNA, abnormal protein, loss of function.

19. Transposons Two transposable elements flanking other DNA, the whole complex ‘hops’. Other genes.

20. 5’ 3’ 5’ 3’5’ N- -C ? ?? ?? ? AAUAAA

21. Assignments Chapter 7: Problems 7.1 - 7.12, Monday: Prokaryotic Genetics, 8.1 - 8.3s