Presentation is loading. Please wait.

Presentation is loading. Please wait.

From: Duggan et.al. Nature Genetics 21:10-14, 1999 Microarray-Based Assays (The Basics) Each feature or “spot” represents a specific expressed gene (mRNA).

Published byHester Merilyn Wiggins Modified over 8 years ago

Similar presentations

Presentation on theme: "From: Duggan et.al. Nature Genetics 21:10-14, 1999 Microarray-Based Assays (The Basics) Each feature or “spot” represents a specific expressed gene (mRNA)."— Presentation transcript:

1 From: Duggan et.al. Nature Genetics 21:10-14, 1999 Microarray-Based Assays (The Basics) Each feature or “spot” represents a specific expressed gene (mRNA). The fluorescent intensity of each feature correlates with the expression level of the gene (mRNA) in the samples under investigation.

2 The Key to Nucleic Acid Detection is “Sequence-Specific Affinity” CAGTAACGGTTCAGTAACGGTT 5’ 3’ GTCATTGCCAAGTCATTGCCAA 5’ 3’ “GC” content (base paring) generally dictates thermodynamics of complementary binding. Tm = Melting Temperature Microarray-Based Assays (The Basics)

3 “PROBE” is DNA spotted (attached) to the solid substrate (non-fluorescent glass slide). “TARGET” is the fluorescence labeled cDNA representation of the mRNA and is hybridized to the probe. Microarray-Based Assays (The Basics)

4 384-well plate Microarray Production Microarray Imaging Microarray Hybridization Microarray Raw Data Analysis Microarray Statistical Data Analysis Biological Samples

5 Microarray Oligonucleotide Probe Design System Experimental Assessment of DNA Binding BehaviorExperimental Assessment of DNA Binding Behavior Design and ImplementationDesign and Implementation

6 1) AGCCCGATGATGAGCGACTCACCACGGGCCACGGCTTCTGACTCTCTTT0 2) AGCCCGATGATGAGCGACTCACCAGGGGCCACGGCTTCTGACTCTCTTT1 3) AGCCCGATGATGAGCCACTCACCACGGGCCAGGGCTTCTGACTCTCTTT2 4) AGCCCGATGATCAGCGACTCACCTCGGGCCACGGCATCTGACTCTCTTT3 5) AGCCCCATGATCAGCGAGTCACCTCGGGCCACGCCTTCTGACTCTCTTT5 Normalized Target/Probe Microarray Oligonucleotide Probes 32  C 42  C 52  C Assessment of Sequence-Specific Cross-Reactivity/Cross-Hybridization Microarray Oligonucleotide ProbesMismatched Base Pairs Kane, MD et. al. Gene Cloning and Expression Technologies (2002) Ch. 35:537-547

7 yicK cDNA yabM cDNA yeiO cDNA Yick_337 Yick_884 Yick_GAP Yeio_997 Yeio_469 Yeio_GAP Yabm_392 Yabm_552 Yabm_GAP A. B. Assessment of Sequence-Specific Cross-Reactivity/Cross-Hybridization Kane, MD et. al. Nucleic Acids Res. (2000) 28:4552-4557

8 80% Overall Homology (Cross-hybridization detected); Yick_337 gcgtacttctgagtagttttgcttccaccgcaaacccgcaaatgttcgcc |||| |||| || || |||| || ||||| |||||||||||||| ||| yeiO 335 gcgtctttcttagcagctttggctcgaccgctaacccgcaaatgtttgcc 74% Overall Homology (No cross-hybridization detected); yicK 471 gttatcgggccaccgctcgcttatgaactggcaatgggatttagttttaa || || || |||||||| ||||||| | || ||||| || || |||| Yeio_469 gtcattggcccaccgctggcttatgccttagcgatgggtttcagctttac 14 Nucleotides; 6 (42%) GC 8 Nucleotides; 6 (75%) GC A. B. Assessment of Sequence-Specific Cross-Reactivity/Cross-Hybridization Kane, MD et. al. Nucleic Acids Res. (2000) 28:4552-4557

9 Probe Pair 1 2 3 4 5 “variable region” DAP Overlap w/ Conserved Region 15 20 25 30 35 “conserved regions” DAP  Assessment of Sequence-Specific Cross-Reactivity/Cross-Hybridization Kane, MD et. al. Nucleic Acids Res. (2000) 28:4552-4557

10 25 30 35 20 15 25 20 15 30 35 Length of Complementary Base Pairing with DAP  cDNA DAP  cDNA Signal (Cy3) DAP cDNA Signal (Cy5) Assessment of Sequence-Specific Cross-Reactivity/Cross-Hybridization Kane, MD et. al. Nucleic Acids Res. (2000) 28:4552-4557

11 1520253035 0 20 40 60 80 100 120 Length of Continuous Complementary Base Pairing with Non-Target (DAP  ) cDNA Ratio of Target Signal (DAP) to Non-Target Signal (DAP  ) Ratio of Target/Non-Target Cross-Hybridization Kane, MD et. al. Nucleic Acids Res. (2000) 28:4552-4557 Assessment of Sequence-Specific Cross-Reactivity/Cross-Hybridization

12 Microarray Oligonucleotide Probe Design System Experimental Assessment of DNA Binding BehaviorExperimental Assessment of DNA Binding Behavior Design and ImplementationDesign and Implementation

13 Microarray Oligonucleotide Probe Design System Objective: Computationally Design Gene-Specific Microarray Probes Commercial Objective: Produce and Sell Pre-Printed Oligo-Probe Microarrays Remove Redundant Entries Confirm RNA vs. Genomic DNA Confirm Species Selection on Each Gene Identify Longest mRNA Identify Splice/Isoform Variants (Segments) Contigs Used to Increase EST Sequence Quality Sequence QC Target Gene List Obtain Sequence Info Genomic Sequence Database Data Flow

14 Microarray Oligonucleotide Probe Design System AGAAGAAGCCGATGATGACGAGGACGATGAGGATGGTGATGAGGTAGAGGAAGAGGCTGAGGAACCCTAC… Sequence QC Target Gene List Obtain Sequence Info Genomic Sequence Database Probe Design Oligonucleotide Probe Length = 46-54 bases

15 Microarray Oligonucleotide Probe Design System 1)Accept if GC content range = 40%-60% 2)Reject 4 or more contiguous bases of G or C (2ndary Structure) 3)Reject palindromic-hairpin sequences greater than 7 bases (2ndary Structure) 4)Reject known splice site sequences 5)Accepted if Calculated Tm = 52.4  C ± 4.0  C 6)No more than 75% homology within the target region of non-target genes. 7)No more than 14 contiguous base pairs with non-target genes. AGAGCACGCGGAGGAGCGTGCGCGGGGGCCCCGGGAGACGGCGGCGGTGGCGGCGCGGGCAGAGCAAGGA… 46 bases 82.6% GC (failure) >4 cont. G or C (failure) AGAAGAAGCCGATGATGACGAGGACGATGAGGATGGTGATGAGGTAGAGGAAGAGGCTGAGGAACCCTAC… 46 bases 54.3% GC Sequence QC Target Gene List Obtain Sequence Info Genomic Sequence Database Probe Design Primary Probe Evaluation

16 Microarray Oligonucleotide Probe Design System 1)Accept if GC content range = 40%-60% 2)Reject 4 or more contiguous bases of G or C (2ndary Structure) 3)Reject palindromic-hairpin sequences greater than 7 bases (2ndary Structure) 4)Reject known splice site sequences 5)Accept if Calculated Tm = 52.4  C ± 4.0  C 6)No more than 75% homology within the target region of non-target genes. 7)No more than 14 contiguous base pairs with non-target genes. Basic Local Alignment Search Tool (BLAST) against published sequences in target species. Parse BLAST Output Accept/Reject Candidate Probe Sequence QC Target Gene List Obtain Sequence Info Genomic Sequence Database Probe Design Primary Probe Eval Secondary Probe Evaluation

17 Microarray Oligonucleotide Probe Design System Target Gene List Sequence QC DNA Sequences Redundant Entries Wrong Species Probe Design High Quality mRNA Primary Probe Evaluation Secondary Probe Evaluation GC Rich/Poor 2ndary Structure Known Splice Site Cross-Hybridization Potential Rank Acceptable Probes Optimal Probes: Nearest to Desired Tm Probe Annotated: GInumber_start_length Obtain Sequence Info Genomic Sequence Database

18 Microarray Oligonucleotide Probe Design System Target Gene List Sequence QC Probe Design Primary Probe Evaluation Secondary Probe Evaluation Rank Acceptable Probes Obtain Sequence Info Genomic Sequence Database Desk Top PC 500 mhz 512 meg RAM Dedicated PC 1 ghz 1 gig RAM SYSTEM PERFORMANCE X  50 genes/hour generating 2 probes for each target gene (mRNA). File-Based Communication

19 Number of Spots Spot Size Replicates MICROARRAY SPOTTER Solid Substrate (slide) Functional Surface Chemistry DNA Probes Oligonucleotide Probes cDNA (PCR) Probes Design Synthesis Purification Clones Amplification Purification DNA Microarrays Record File (.gal file) Processing Chemistry Storage Delivery Pre-Hybridization Chemistry HYBRIDIZATION IMAGING Raw Data Image (.tif file) Gene Specific Data Biological/Bioinformatics Analysis Time, Temp, Buffers, Wash Resolution, Region of Interest Raw Data Analysis Spot Finding, Background Subtraction, Signal Intensity, Normalization Sample Control Sample Test Sample RNA Isolation RT (Fluorescence) Labeling STUDY DESIGN and OBJECTIVES

Download ppt "From: Duggan et.al. Nature Genetics 21:10-14, 1999 Microarray-Based Assays (The Basics) Each feature or “spot” represents a specific expressed gene (mRNA)."

Similar presentations

Microarray Technique, Analysis, and Applications in Dermatology Jennifer Villaseñor-Park 1 and Alex G Ortega-Loayza 2 1 Department of Dermatology, University.

Microarray Technique, Analysis, and Applications in Dermatology Jennifer Villaseñor-Park 1 and Alex G Ortega-Loayza 2 1 Department of Dermatology, University.
Recombinant DNA Technology

Recombinant DNA Technology
BiGCaT Bioinformatics Hunting strategy of the bigcat.

BiGCaT Bioinformatics Hunting strategy of the bigcat.
The Rice Functional Genomics Program of China cDNA microarray database (RIFGP-CDMD) consists of complete datasets, including the probe sequences, microarray.

The Rice Functional Genomics Program of China cDNA microarray database (RIFGP-CDMD) consists of complete datasets, including the probe sequences, microarray.
Chapter Six Nucleic Acid Hybridization: Principles & Applications 1.Preparation of nucleic acid probes: - DNA: from cell-based cloning or by PCR. Probe.

Chapter Six Nucleic Acid Hybridization: Principles & Applications 1.Preparation of nucleic acid probes: - DNA: from cell-based cloning or by PCR. Probe.
Microarray Simultaneously determining the abundance of multiple(100s-10,000s) transcripts.

Microarray Simultaneously determining the abundance of multiple(100s-10,000s) transcripts.
Microarray technology and analysis of gene expression data Hillevi Lindroos.

Microarray technology and analysis of gene expression data Hillevi Lindroos.
RNA-Seq An alternative to microarray. Steps Grow cells or isolate tissue (brain, liver, muscle) Isolate total RNA Isolate mRNA from total RNA (poly.

RNA-Seq An alternative to microarray. Steps Grow cells or isolate tissue (brain, liver, muscle) Isolate total RNA Isolate mRNA from total RNA (poly.
TIGR Spotfinder: a tool for microarray image processing

TIGR Spotfinder: a tool for microarray image processing
Probe design for microarrays using OligoWiz Rasmus Wernersson, Assistant Professor Center for Biological Sequence Analysis Technical University of Denmark.

Probe design for microarrays using OligoWiz Rasmus Wernersson, Assistant Professor Center for Biological Sequence Analysis Technical University of Denmark.
DNA Microarray: A Recombinant DNA Method. Basic Steps to Microarray: Obtain cells with genes that are needed for analysis. Isolate the mRNA using extraction.

DNA Microarray: A Recombinant DNA Method. Basic Steps to Microarray: Obtain cells with genes that are needed for analysis. Isolate the mRNA using extraction.
Class 6 DNA Arrays BIOMEMS, Fall 2011. Content u Polymerase Chain Reaction or PCR u DNA Detection Process u DNA Micro Arrays u Electronic DNA Arrays u.

Class 6 DNA Arrays BIOMEMS, Fall Content u Polymerase Chain Reaction or PCR u DNA Detection Process u DNA Micro Arrays u Electronic DNA Arrays u.
Probe design for microarrays using OligoWiz. Sample Preparation Hybridization Array design Probe design Question Experimental Design Buy Chip/Array Statistical.

Probe design for microarrays using OligoWiz. Sample Preparation Hybridization Array design Probe design Question Experimental Design Buy Chip/Array Statistical.
DNA Arrays …DNA systematically arrayed at high density, –virtual genomes for expression studies, RNA hybridization to DNA for expression studies, –comparative.

DNA Arrays …DNA systematically arrayed at high density, –virtual genomes for expression studies, RNA hybridization to DNA for expression studies, –comparative.
3 September, 2004 Chapter 20 Methods: Nucleic Acids.

3 September, 2004 Chapter 20 Methods: Nucleic Acids.
RNA-Seq An alternative to microarray. Steps Grow cells or isolate tissue (brain, liver, muscle) Isolate total RNA Isolate mRNA from total RNA (poly.

RNA-Seq An alternative to microarray. Steps Grow cells or isolate tissue (brain, liver, muscle) Isolate total RNA Isolate mRNA from total RNA (poly.
Microarrays and Gene Expression Analysis. 2 Gene Expression Data Microarray experiments Applications Data analysis Gene Expression Databases.

Microarrays and Gene Expression Analysis. 2 Gene Expression Data Microarray experiments Applications Data analysis Gene Expression Databases.
1 Characterization, Amplification, Expression Screening of libraries Amplification of DNA (PCR) Analysis of DNA (Sequencing) Chemical Synthesis of DNA.

1 Characterization, Amplification, Expression Screening of libraries Amplification of DNA (PCR) Analysis of DNA (Sequencing) Chemical Synthesis of DNA.
Introduce to Microarray

Introduce to Microarray
Review of important points from the NCBI lectures. –Example slides Review the two types of microarray platforms. –Spotted arrays –Affymetrix Specific examples.

Review of important points from the NCBI lectures. –Example slides Review the two types of microarray platforms. –Spotted arrays –Affymetrix Specific examples.

Similar presentations

Ads by Google