2. Honors Biology Chapter 10 Nucleic Acids and Protein Synthesis

3. What IS the physical “factor” identified by Mendel? How do “factors” produce phenotypes? What is the molecular basis for the “genetic code?” Scientists could narrow it down to molecules found in the nucleus: DNA, RNA, or protein? Most thought proteins, because they’re much more diverse and complex

4. Griffith’s Transformation While working with pneumonia in 1928, Griffith transformed or changed bacteria from one form to another.

5. Avery’s Experiments What is the “transforming factor”? Avery used enzymes to destroy molecules from the heat killed cells before transforming harmless cells. Concluded: DNA is the transforming factor.

6. Hershey-Chase Experiment Alfred Hershey & Martha Chase: Radioactively label viral protein vs. DNA, let the phages infect bacteria, then separate them Bacteria had the DNA trace, not the protein trace

7. Hershey-Chase Results Proteins stay outside of cell Nucleic Acids enter cell Conclusion: DNA is the transforming factor and the genetic code

8. Rosalind Franklin & Photo 51 Used X-ray diffraction to photograph crystallized DNA molecules. Showed the helical shape and repeating structure of the DNA molecule

9. The Double Helix In 1953, James Watson and Francis Crick used scientific evidence reported by other scientists to suggest a model for the DNA structure as a double helix

10. Nucleic Acids Examples  DNA  Deoxyribonucleic Acid  RNA  Ribonucleic Acid RNA Information molecules

11. DNA Nucleic Acids  Function:  genetic material  stores information  genes  blueprint for building proteins DNA  RNA  proteins  transfers information  blueprint for new cells  blueprint for next generation proteins

12. Nucleic acids  Building block = nucleotides  5 different nucleotides  different nitrogen bases  A, T, C, G, U nucleotide – nucleotide – nucleotide – nucleotide phosphate sugar N base Nitrogen bases I’m the A,T,C,G or U part!

13. 4 Types of Nitrogenous Bases in DNA Purines: have 2 rings (Adenine and Guanine) Pyrimidines: have 1 ring (Thymine and Cytosine)

14. Complementary Base Pairing Chargaff’s Base Pairing Rule: Chargaff determined that the amount of Adenine = amount of Thymine, and the amount of Guanine = the amount of Cytosine. The bases are connected to each other in the double helix by hydrogen bonds. A pairs with T C pairs with G

15. Nucleotide chains  Nucleic acids  nucleotides chained into a polymer  DNA  Double stranded  A, C, G, T  RNA  Single stranded  A, C, G, U phosphate sugar N base phosphate sugar N base phosphate sugar N base phosphate sugar N base Strong covalent bonds RNA

16. DNA  Double strand twists into a double helix  Hydrogen bonds between nitrogen bases that join the 2 strands are weak  the two strands can separate and reattach with relative ease

17. Organizing & packaging DNA nucleus cell DNA nucleus cell 4 chromosomes in this organism DNA in chromosomes in everyday “working” cell DNA in chromosomes in cell getting ready to divide DNA has been “wound up”

18. Chromosomes of Human Female 46 chromosomes 23 pairs

19. Paired bases  All species on Earth have the same nucleotide structure  The difference between individuals = the number & order of nucleotides

20. Copying DNA  A dividing cell duplicates its DNA in S phase  creates 2 copies of all DNA (sister chromatids)  separates the 2 copies to 2 daughter cells nucleus cell DNA

21. Copying DNA  Matching bases allows DNA to be easily copied

22. Making new DNA  Copying DNA  replication  DNA starts as a double-stranded molecule  matching bases (A:T, C:G)  then it unzips…

23. DNA replication  Strands “unzip” at the weak bonds between bases  Done by an enzyme, helicase

24. DNA replication DNA polymerase  Enzyme DNA polymerase  matches free- floating bases to exposed strand DNA bases in nucleus

25. DNA Polymerase Copying DNA  Build daughter DNA strand  use original parent strand as “template”  add new matching bases  synthesis enzyme = DNA polymerase

26. New copies of DNA  Get 2 exact copies of DNA to split between new cells  Each copy = one original strand, one new strand DNA polymerase DNA polymerase

27. DNA Replication-Review

28. Copying & packaging DNA Copying DNA Coil DNA into compact chromosomes  When cell is ready to divide…  copy DNA first, then…  coil up doubled chromosomes like thread on a spool…  now can move DNA around cell without having it tangle & break

29. double-stranded human chromosomes ready for mitosis

30. From Gene to Protein

31.  DNA has the information to build proteins DNA  Proteins  Cells  Bodies proteins cells bodies DNA gets all the glory, Proteins do all the work

32. What do we know?  DNA  DNA is the genetic information  Proteins  proteins run living organisms  enzymes  all chemical reactions in living organisms are controlled by enzymes (proteins)  structure  all living organisms are built out of proteins  DNA is the instructions for making proteins

33. nucleus What do we know?  DNA  DNA is in the nucleus  want to keep it there = protected  “locked in the vault”  Proteins  made by a “protein factory” in cytoplasm  ribosomes  Need to get gene (DNA) information from nucleus to cytoplasm  need a messenger!  need a copy of DNA  mRNA

34. cytoplasm nucleus build proteins DNA RNA Who is the messenger?  messenger RNA (mRNA) mRNA

35. Protein Synthesis: Part 1 So… How does the cell get the instructions from the nucleus to the ribosomes? DNA – stores info to make proteins RIBOSOMES – where proteins are made CYTOPLASM NUCLEUS Where are proteins made?Where are the instructions to make proteins? CELL It makes a copy to send called – messenger RNA mRNA

36. From nucleus to cytoplasm DNA transcription nucleus cytoplasm protein translation trait

37. Flow of Genetic Information 1. A gene or segment of DNA is located on a chromosome 2. The cell uses transcription to copy the gene into a piece of mRNA 3. The RNA leaves the nucleus and goes to a ribosome 4. The ribosome uses translation to direct the assembly of a protein 5. Gene is now expressed in the cell

38. RNA = Ribonucleic Acid Structure: Made of a single strand of nucleotides Nucleotides use Ribose instead of Deoxyribose Nitrogen base thymine is replaced by Uracil Types: Messenger RNA (mRNA): single stranded- used to carry DNA code out of nucleus “working copy” Transfer RNA (tRNA): binds to specific amino acids, used to build proteins Ribosomal RNA (rRNA): makes up ribosomes along with proteins

39. DNA vs. RNA DNA  deoxyribose sugar  nitrogen bases  G, C, A, T  T = thymine  T : A  C : G  double stranded RNA  ribose sugar  nitrogen bases  G, C, A, U  U = uracil  U : A  C : G  single stranded

40. DNA vs. RNA DNA RNA

41. Transcription  Making mRNA from DNA  DNA strand is the template (pattern)  match bases  U : A  G : C  Enzyme  RNA polymerase

42. Matching bases of DNA & RNA  Double stranded DNA unzips AGGGGGGTTACACTTTTTCCCCAA

43. Matching bases of DNA & RNA  Double stranded DNA unzips AGGGGGGTTACACTTTTTCCCCAA

44. Matching bases of DNA & RNA  Match RNA bases to DNA bases on one of the DNA strands U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A

45. Matching bases of DNA & RNA  U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA

46. Transcription Steps 1.DNA has 2 complementary strands that follow base pairing rules (A-T and C-G). 2.RNA Polymerase binds to the promoter (specific place for polymerase to bind) on the DNA and begins transcription 3.DNA strands separate or unzip. 4.One of the original strands serves as a template. RNA polymerase binds new RNA nucleotides to the template strand following base pairing rules. (A-U, C-G) 5.mRNA leaves the nucleus and carries the instructions to the ribosomes. The DNA “re-zips”. A – T C – G G – C A – T C – G T – A A - - T C - - G G - - C A - - T C - - G T - - A A - U - T C - G - G G - C - C A - U - T C - G - G T - A - A A – T U C – G G G – C C A – T U C – G G T – A A 123 - 45

47. nucleus What do we know?  DNA  instructions remain in nucleus  mRNA  has the instructions for building proteins from DNA  Proteins  built as chains of amino acids  What reads RNA?  need a mRNA reader!  ribosome a a a aaa a UCCCCCCAAUGUGAAAAAGGGGUU

48. a a a aaa a mRNA From gene to protein DNA transcription nucleus cytoplasm protein translation trait UCCCCCCAAUGUGAAAAAGGGGUU ribosome mRNA leaves nucleus through nuclear pores proteins synthesized by ribosomes using instructions on mRNA

49. a a a aaa a What do we know?  mRNA  has the instructions for building proteins from DNA  Proteins  built as chains of amino acids  What reads mRNA?  ribosome  What brings the right amino acid to attach to the protein chain?  need an amino acid transporter! ribosome UCCCCCCAAUGUGAAAAAGGGGUU

50. a a a aaa a mRNA From gene to protein DNA transcription nucleus cytoplasm protein translation trait UCCCCCCAAUGUGAAAAAGGGGUU ribosome tRNA a Who is the transporter? tRNA transports amino acids

51. RNA to protein  mRNA leaves nucleus  mRNA goes to ribosomes in cytoplasm  Proteins built from instructions on mRNA aa How? mRNA UCCCCCCAAUGUGAAAAAGGGGUU

52. How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

53. AUGCGUGUAAAUGCAUGCGCC mRNA mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ?  Codon  block of 3 nucleotides codons ribosome

54. How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA amino acid tRNA anti-codon codon UAC Met GCA Arg CAU Val

55. ribosome mRNA to protein = Translation  The reader  ribosome  The transporter  transfer RNA (tRNA) aa tRNA mRNA UCCCCCCAAUGUGAAAAAGGGGUU GGU aa tRNA UAC aa tRNA GA C aa AGU

56. Translation Steps 1. Initiation: Ribosome attaches to the mRNA at the start codon (AUG) 2. tRNA with the complementary anti-codon (UAC) binds to the mRNA codon bringing the amino acid methionine with it. 3. Ribosome shifts down the mRNA to the next codon. 4. Elongation: Another tRNA with the complementary anti- codon binds to the mRNA codon. The amino acid from the tRNA binds to methionine. 5. The ribosome shifts again, another tRNA brings another amino acid to bind to the growing amino acid chain. 6. Termination: Process continues until the ribosome reads a stop codon, at which time it releases the finished amino acid chain (AKA: protein)

57.  For ALL life!  strongest support for a common origin for all life  Code is redundant  several codons for each amino acid  mutation insurance!  Start codon  AUG  methionine  Stop codons  UGA, UAA, UAG The mRNA code

58. Protein Synthesis mRNA carries the instructions for making proteins which are made of amino acids. BUT …. RNA language – A, U, C, G Protein language – 20 different amino acids (Ex. arginine, valine, serine, etc.) How would you follow directions that were written in a different language? TRANSLATION

59. The Genetic Code RNA codes have to be translated into a protein’s amino acid sequence Read in 3 letter nucleotide “words” called codons. Each codon codes for a specific amino acid Genetic code is universal to all living things (hint that they are all related) Special Codons: Start: AUG: codes for methionine—helps a ribosome bind on and starts the translation Stop: UAA, UAG, UGA: tells the ribosome to stop translating and release the finished protein

60. The Genetic Code “Magic RNA Decoder Ring” Read by starting at the center and working outwards.

61. a a a aaa a mRNA From gene to protein DNA transcription nucleus cytoplasm protein translation trait UCCCCCCAAUGUGAAAAAGGGGUU ribosome tRNA a

62. protein transcription cytoplasm nucleus translation trait

63. From gene to protein

64. Can you tell the story? DNA transcription ribosome tRNA amino acids protein translation mRNA

65. Mutations

66. Genes  Genes code for proteins  the order of A, T, C & G  Proteins create traits DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC aa protein trait

67. Transcription & Translation  Genes code for proteins through…  transcription  translation trait

68. Mutations  Mutations are changes in DNA sequences  changes to the order of A, T, C & G  different order = different amino acid in protein  different protein structure = different protein function BbbbBB

69. Mutations  Point mutations  single base change  silent mutation  no amino acid change  redundancy in code  missense  change amino acid  nonsense  change to stop codon

70. Point mutation leads to Sickle cell anemia What kind of mutation?

71. Sickle cell anemia  Primarily Africans  recessive inheritance pattern  strikes 1 out of 400 African Americans

72. Mutations  Frameshift  shift in the reading frame  changes everything “downstream”  insertions  adding base(s)  deletions  losing base(s) Where would this mutation cause the most change: beginning or end of gene?

73. THERAATANDTHECATATETHEREDBAT Frameshift mutations THERATANDTHECATATETHEREDBAT THERTANDTHECATATETHEREDBAT THERATANDTHECATATETHEREDBAT THERTANDTHECATATETHEREDBAT Deletion Insertion

74. Cystic fibrosis  Primarily whites of European descent  strikes 1 in 2500 births  1 in 25 whites is a carrier (Aa)  normal allele codes for a membrane protein that moves Cl - across cell membrane  mutant channel limit movement of Cl - (& H 2 O) across cell membrane  thicker & stickier mucus coats cells  mucus build-up in the pancreas, lungs, digestive tract & causes bacterial infections  without treatment children die before 5; with treatment can live past their late 20s