1. Figure S1. Effect of the plasmid copy number on silencing of lacZ. (A) For the LacZ assay, wild-type cells were transformed with plasmids harboring the indicated features and cultured in the presence of IPTG to mid-logarithmic phase. LacZ activities are represented as the mean ± standard deviation of three replicates. (B) lacZ mRNA was quantified by real-time quantitative RT-PCR. Used transformants and culture conditions are same as in the panel (A). Relative lacZ mRNA level is shown as fold-change compared with lacZ mRNA level of a transformant with “pBR322 ori, -” (the leftmost bar). 0 10 20 30 40 50 60 70 80 90 0 0.5 1 1.5 2 2.5 pBR322 pACYC pSC101 RK2 pSC101 H ori asRNA lacZ - pBR322 pACYC pSC101 RK2 pSC101 H lacZ - - - - pBR322 pACYC pSC101RK2pSC101 H lacZ - pBR322 pACYC pSC101 RK2 pSC101 H lacZ - - - - LacZ activity (Units) Relative lacZ mRNA level (fold) (A)(B)

2. Figure S2. Effect of the plasmid copy number on silencing of ackA. For the AckA assay, wild-type cells were transformed with plasmids harboring the indicated features and cultured in the presence of IPTG to mid-logarithmic phase. AckA activities are represented as the mean ± standard deviation of three replicates. 0 20 40 60 80 100 120 140 160 180 AckA (Units) pBR322 pACYC pSC101RK2pSC101 H ackA - pBR322pACYC pSC101RK2pSC101 H ackA - - - - ori asRNA

3. Figure S3. Silencing of pepN using an arabinose-inducible vector. (A) Arrows indicate open reading frames or promoters, and a circle indicates an ori. Details of pHN649 are described in our previous report (Nucleic Acids Res., 34, e138). The pepN antisense sequence same as described in the body text was inserted into the multiple cloning site (MCS) of pHN649, yielding pHN1365. (B) For the PepN assay, wild-type cells were transformed with plasmids harboring the indicated features and cultured to mid-logarithmic phase. The names of the plasmids used are pHN649 and pHN1365. PepN activities are represented as the mean ± standard deviation of three replicates. Open and gray bars are results with the absence and presence of 0.3% L-arabinose, respectively. (C) The pepN PTasRNA was detected by northern blot (lower panel). The rRNA bands stained with ethidium bromide (upper panel) are shown as loading controls. 0 5 10 15 20 25 30 35 40 pACYC asRNA pepN - ori rRNAs pepN asRNA (C) arabinose - + - + pACYC asRNA pepN - ori PepN (Units) pHN649 3.9 kb araC P bad Chl r pACYC ori PT-MCS (A) (B)

4. Figure S4. The ackA-pta loci of wild-type (WT) and disruptants (  ackA,  pta, and  ackA  pta) are shown, along with their AckA and Pta activities (% relative to that of WT). N.D. indicates not detected. The disruptants were generated from the WT strain using the “marker- less gene disruption method” (Mol. Microbiol., 5, 1447-1457). Dashed lines are deleted parts. ackA (473-1675) pta (1761-3890) 0.5 kb yfcC (4080->4345)  ackA  pta yfbV (<1-135) WT 514 3834  ackA 514 1339 1846 3834  pta AckA (%) Pta (%) 62 ±12 N.D. 100 N.D. 69 ± 15 N.D.

5. Figure S5. Rescue of growth retardation that is caused by ackA and/or pta PTasRNAs by overexpressing ackA and/or pta genes. (A) The plasmid pHN1032 is an IPTG-inducible vector. Note that it is not a vector for expressing PTasRNAs but is an ordinary expression vector. It was constructed by cloning a 1.5-kb fragment excised from pTrc-99a (Amersham Biosciences Corp.) by digestion with SphI and EcoRI into the SphI-EcoRI moiety of pHN540u (Nucleic Acids Res., 34, e138). The ackA and pta full-length fragments were PCR-amplified using primers (TTCCATGGCGAGTAAGTTAGTACTGGT and GTCTCGAGTCAGGCAGTCAGGCGGCTCGC, and AACTCGAGGAGATATACCATGCTGATCCCTACCGGAACCAGC and GAACTAGTTACTGCTGCTGTGCAGACTGAA, respectively) and the genomic DNA of the MG1655 strain as a template. The ackA fragment was cloned into the NcoI-XhoI moiety of pHN1032, thereby yielding pHN1371. To construct pHN1372, the pta fragment was cloned into the XhoI-SpeI moiety of pHN1371. (B and C) Growth curves of the indicated transformants are shown. The wild-type strain was co-transformed with the PTasRNA vector(s) carrying the indicated features and one of pHN1032, pHN1371, or pHN1372. Then, the co-transformants were cultured in the presence of IPTG. 0 200 400 600 800 1000 2468 Time (hr) Turbidity (Arbitrary units) 101214 pBR322 - pSC101 H - pBR322 - pBR322 ackA pSC101 H pta pBR322 ackA (+ pHN1372) 0 200 400 600 800 1000 2468 Time (hr) Turbidity (Arbitrary units) 101214 pBR322 - (+ pHN1032) pBR322 - (+ pHN1371) pBR322 ackA (+ pHN1032) pBR322 ackA (+ pHN1371) (B) (C) pHN1032 4.1 kb lacI q P trc Chl r pACYC ori MCS pHN1371 pta ackA (A) (+ pHN1032) ackA pHN1372 ori asRNA (+ rescue vector) ori asRNA (+ rescue vector)

6. Figure S6. Effect of the different asRNA sequence on silencing of lacZ. (A) The partial DNA sequence of lacZ is shown. A boxed nucleotide indicates the transcription start position, and the putative ribosome-binding site and translation start codon are shown in blue and red characters, respectively. Four versions of lacZ asRNA sequences were used to construct PTasRNA expression vectors, and those sequences are underlined with red (version 1), blue (version 2), green (version 3), and magenta (version 4). (B) For the LacZ assay, wild-type cells were transformed with plasmids harboring the indicated features and cultured in the presence of IPTG to mid-logarithmic phase. LacZ activities are represented as the mean ± standard deviation of three replicates. 0 5 10 15 20 25 30 35 (A) (B) LacZ activity (Units) aggctttacactttatgcttccggctcgtatgttgtgtggaattgtg agcggataacaatttcacacaggaaacagctatgaccatgattacgg attcactggccgtcgttttacaacgtcgtgactgggaaaaccctggc gttacccaacttaatcgccttgcagcacatccccctttcgccagctg gcgtaatagcgaagaggcc Ver. 1 Ver. 2 Ver. 3 Ver. 4 pACYC lacZ ver. 1 - ori asRNA pACYC lacZ ver. 2 pACYC lacZ ver. 3 pACYC lacZ ver. 4