2. Admixture Mapping Controlled Crosses Are Often Used to Determine the Genetic Basis of Differences Between Populations. When controlled crosses are not an option, can use natural admixture as a substitute, and must use genetic markers to determine the degree of admixture in the sampled individuals.

3. Admixture Between Two Demes Ancestral Gene Pools European Population West African Population Aa p E q E Aa p W q W Gene Pools in Present North America Aa p E Aa p A = (1-M)p E +Mp W q A 1 1-M M q E European AmericansAfrican Americans Note, M is now measuring amount of African Ancestry

4. End-Stage Kidney (Renal) Disease (ESKD) Is A Major Disease In the USA and Other Countries 100,000 Americans develop ESKD each year, and it is associated with high health care costs and high mortality The cumulative life time risk for ESKD varies with ethnicity: 7.5% in African-Americans 2.1% in European-Americans The cause of this increased risk is not explained by social-economic status, lifestyle factors, etc.

5. Admixture Between Two Demes Basic strategy of admixture mapping: Subdivide the African American Sample into Cases (those with ESKD) and Controls (matched for as many other variables as possible, but do NOT have ESKD). Idea: genes increasing risk of ESKD should be in genomic regions of West African Ancestry.

6. Ancestry informative markers are used to compute the ancestry across the chromosomes of cases and controls Bercovici S. et.al. Genome Res. 2008;18:661-667 ©2008 by Cold Spring Harbor Laboratory Press African European

7. Admixture Between Two Demes For this to work you need to have markers that cover the whole genome and that are informative about the population differences between Africans and Europeans. In this study, 2500 SNPs were used. The SNP panel was then run on a sample of 723 Cases and 1,059 Controls. An independent sample was run by Kopp et al, and both studies had identical results.

8. Admixture Between Two Demes

9. The Sharp Peak Fell Inside A Large Gene Known as MYH9

10. MYH9

11. Linkage, GWAS, and Admixture Mapping All Require Recombination. Recent Studies Show That Recombination Is Often Clustered Into “Hotspots”, Leaving Large Genomic Blocks Without Recombination. A Problem of Scale E.g, Disequilibrium patterns from previous work on MYH9:

12. Haplotypes & Recombination The Next Phase of the Analysis Was To Organize the SNP Genotype Data Into Haplotype Data and Determine The Role of Recombination In this 107,000 base pair region. We used the program PHASE to do the initial recombination inferences, followed by the more sensitive Crandall & Templeton algorithm.

13. Recombination Inferences Hotspot Not Detected With PHASE

14. Theoretical Decay of LD in a Random-Mating Population In a genomic region with no recombination, the LD created by mutation never dissipates.

15. In Genomic Regions of Little to No Recombination, We Can Estimate Haplotype Trees, and The Tree Can Be Used to Analyze Genotype/Phenotype Associations.

16. Rationale: Functional Mutations Define Clades (branches of an evolutionary tree) In Regions of Low Recombination. 1 Ancestral Haplotype: 2 4 3 5 67 Neutral Mutation Functional Mutation Time This entire clade of haplotypes bears the same functional mutation

17. Central Haplotype Tree TCTCGCTCCTGTTGTTTTCATC TCTCGCTCCTGTTGTTTTCGCC

18. Haplotype Trees

19. Nested Design of Central Tree

23. 3-2 3-1 Total CladogramControlESKD(pe-pc)/pc 3-1122129-1.092 3-21864490.286 308578 p-value< 0.0001 alpha0.005

24. N.S. 0.004 < 0.0001 N.S. 0.005 ESKD Associations In Blocks < 0.0001 0.004

25. ESKD Associations In Hotspots The SNPs In The Recombinational Hotspots Have Been Ignored Up To Now, So Each of These SNPs Was Then Tested For ESKD Associations One SNP Showed A Significant Effect

26. ESKD Associations In MYH9 Used Logistic Regression To Test For the Simultaneous Effects of These Three Genetic Risk Factors 3-1 vs 3-2 C vs T 1-1 vs 1–2 1-3 vs rest

27. ESKD Associations In MYH9 3-1 vs 3-2 C vs T 1-1 vs 1–2 1-3 vs rest Detected three separable main effects and one strong interaction between the central and end haplotype blocks. Results of Logistic Regression:

28. A Major Advantage of the Candidate Locus Approach Is That Interactions Between Genes (Epistasis) and Between Genes and Environments Can Be Studied. However, interactions challenge our usual concepts of causation and scientific inference.

29. Epistasis Between ApoE and LDLR ApoB HDL particle containing cholesterol ApoE

30. Epistasis Between ApoE and LDLR for LDL Cholesterol LDLR Genotype

31. Two Populations Frequency ApoE-4 Allele = 0.152 Frequency ApoE-3 Allele = 0.77 Frequency LDLR A2 Allele = 0.78 Frequency ApoE-4 Allele = 0.95 Frequency ApoE-3 Allele = 0.03 Frequency LDLR A2 Allele = 0.50

32. Quantitative Genetic Components As a Function of Allele Frequencies: A.  4 allele at ApoE is Rare, A2 at LDLR Common; B. Reversed

33. Interactions Also Exist Between Genetic and Environmental Factors (e.g, Macular Degeneration, the cause of 90% of all legal blindness)

34. Macular Degeneration Schmidt, S., M. A. Hauser, et al. (2006). Am J Hum Genet 78(5): 852-864. chromosome 10q26 LD genome scan

35. Macular Degeneration Schmidt, S., M. A. Hauser, et al. (2006). Am J Hum Genet 78(5): 852-864. Genotype Frequencies in Subjects with MD Genotype Frequencies in Subjects without MD General Population

36. Macular Degeneration Schmidt, S., M. A. Hauser, et al. (2006). Am J Hum Genet 78(5): 852-864. Linkage genome scan

37. TA Manolio et al. Nature 461, 747-753 (2009) doi:10.1038/nature08494 There is a strong relationship between frequency and effect size in genetic association studies This category is expected to be rare in any system where true causation arises from interactions among components.

38. Autoimmune Diseases & Allergies

39. Hygiene Hypothesis

41. Braun-Fahrlander et al (2002) showed that children of farmers in Central Europe that were exposed to high levels of bacterial endotoxin in house dust had low levels of allergies & asthma compared to children from the same communities exposed to low levels of endotoxin. This suggests a candidate environment (endotoxin loads in house dust), and a candidate gene, CD14

42. Hygiene Hypothesis

43. CC has highest risk CC has lowest risk

44. Interactions of Genes With Other Genes and With Environmental Factors Ensure That The Phrase “The Gene For X” Is Often False and Actively Misleading.

45. Using Interactions in Treatments Decline in LDL-Cholesterol Levels Genetics Has the Potential of Making Medicine Much More Individualized

46. Candidate Genes & Human Disease The Major Application of Genetics to Risk Prediction and Treatment Is Not “Gene Therapy” But Rather In Understanding Genetic and Environmental Interactions. This Requires A Shift In Medicine From Treating The Diseases of Individuals To Treating The Individual With The Disease.

47. Complexity Is Both A Challenge and an Opportunity