Presentation is loading. Please wait.

Presentation is loading. Please wait.

Table S1. CD44 expression and clinicopathologic characteristics Cases (n=54) CD44 protein expression P value* Negativ e WeakStrong (n=8)(n=23) Age <60221129.

Published byRafe Dixon Modified over 8 years ago

Similar presentations

Presentation on theme: "Table S1. CD44 expression and clinicopathologic characteristics Cases (n=54) CD44 protein expression P value* Negativ e WeakStrong (n=8)(n=23) Age <60221129."— Presentation transcript:

1 Table S1. CD44 expression and clinicopathologic characteristics Cases (n=54) CD44 protein expression P value* Negativ e WeakStrong (n=8)(n=23) Age <60221129 0.175 ≥603271114 Gender Male30413 0.943 Female24410 Tumor Stage I/II4482313 0.024 III/IV4004 Tissue Types Primary Tumor48823170.018 Metastases6006 Tumor Differentiation Well (Grade 1)114430.039 Moderate (Grade 2)213126 Poor (Grade 3)221714 *P values were based on Fisher’s exact test. Table S1

2 Cases (n=54) KLF4 protein expression P value* NegativeWeakStrong (n=20)(n=24)(n=10) Age <60 226115 0.475 ≥60 3214135 Gender Male 3013116 0.454 Female 247134 Tumor Stage I/II 44112310 0.114 III/IV 4310 Tissue Types Primary Tumor 481424100.002 Metastases 6600 Tumor Differentiation Well (Grade 1)11155 0.006 Moderate (Grade 2)21795 Poor (Grade 3)2212100 Table S2. KLF4 expression and clinicopathologic characteristics *P values were based on Fisher’s exact test. Table S2

3 Primers Sequence (5' to 3') Tm ( ℃ ) Length (bp) mCD44-for5'-GGAGATCAGGATGACTCCTTCT-3'58345 mCD44-rev5'-AGTCCTTGGATGAGTCTCGATC-3' hCD44v-for5'-TCCCAGACGAAGACAGTCCCTGGAT-3'6387; 430 hCD44v-rev5'-CACTGGGGTGGAATGTGTCTTGGTC-3' h-GAPDH-for5'-ACCACAGTCCATGCCATCAC-3'62422 h-GAPDH-rev5'-TCCACCACCCTGTTGCTGTA-3' hCD44 (CHIP)-for5´-CAATCTCAAAAGGCTTCC -3´55335 hCD44 (CHIP)-rev5´-TTCATCTTCCCATACAAC-3´ hβ-actin-for5'-AGAAAATCTGGCACCACACC-3'60 395 hβ-actin-rev5'-CTCCTTAATGTCACGCACGA-3' mβ-actin-for5'-TTCTTTGCAGCTCCTTCGTT-3'59 430 mβ-actin-rev5'-GGGGTGTTGAAGGTCTCAAA-3' hESRP1-for5'-GACGGAGGACTGCAAAGAAG-3'60 161 hESRP1-rev5'-CATGAAGCTGCCCATCAGTA-3' hKLF4-for5'-GCTGGACCCCCTCTCAGCAATGG-3'63319 hKLF4-rev5'-ATCACAAGTGGGTGGCGGTCC-3' mKlf4 (loxp) -1exon 1, 5'-CTGGGCCCCCACATTAATGAG-3'61 425;296;172 mKlf4 (loxp) -2exon 2, 5'-TCGCTGACAGCCATGTCAGAC-3' mKlf4 (loxp) -3intron 3, 5'-CCAGCAGAGCCGTTCTGGCTG-3' Table S3. Specific primers for target and control genes Table S3

4 AntibodyCompanyCat#Dilution α-TubulinOncogeneCP06-100UG1:3000 β-actinSanta cruzSC-16151:3000 CD44 (F4)Santa cruzSC-99601:2000 CD44 (IM7)Santa cruzSC-188491:500 CD133Santa cruzSC-237971:1000 ESRP1SigmaHPA0237201:500 E-cadherin (CDH1)BD pharmingen6101821:2000 NanogSanta cruzSC-337591:1000 KLF4ABGENTAm2725a 1:800 β-cateninCell signaling technology9587 1:2000 OCT4Cell signaling technology2750 1:2000 VimentinBD pharmingen550513 1:2000 VillinSanta cruzSC-28283 1:1500 M2 (Anti-Flag)SigmaF3165 1:2000 Table S4. Antibodies for target and control protein expression in Western blot analyses Table S4

Download ppt "Table S1. CD44 expression and clinicopathologic characteristics Cases (n=54) CD44 protein expression P value* Negativ e WeakStrong (n=8)(n=23) Age <60221129."

Similar presentations

Legends for supplementary figures Fig s1. A: Western blot showing the suppression of SRp20 expression by Dox induction of SRp20 siRNAs in SKOV3 sublines.

Legends for supplementary figures Fig s1. A: Western blot showing the suppression of SRp20 expression by Dox induction of SRp20 siRNAs in SKOV3 sublines.
Gene Expression And Regulation Bioinformatics January 11, 2006 D. A. McClellan

Gene Expression And Regulation Bioinformatics January 11, 2006 D. A. McClellan
BME 130 – Genomes Lecture 7 Genome Annotation I – Gene finding & function predictions.

BME 130 – Genomes Lecture 7 Genome Annotation I – Gene finding & function predictions.
Figure S1: Diagram of alleles Figure S1: Vectors used to create transgenic and knock-in mice. A) Loxp-GFP/Stop-Loxp SB11 cDNA knocked into the Rosa26 locus.

Figure S1: Diagram of alleles Figure S1: Vectors used to create transgenic and knock-in mice. A) Loxp-GFP/Stop-Loxp SB11 cDNA knocked into the Rosa26 locus.
Genetic Alterations of TP53 Gene in Brain Astrocytic Tumours Methodology Θ Eighty-three brain tumor biopsies were collected and used in this study. Thirty.

Genetic Alterations of TP53 Gene in Brain Astrocytic Tumours Methodology Θ Eighty-three brain tumor biopsies were collected and used in this study. Thirty.
Kerrington Smith, M.D. CTOS Nov 14, 2008

Kerrington Smith, M.D. CTOS Nov 14, 2008
Table S1. Characteristics of breast tumor and normal breast tissue samples. Relevant characteristics of breast tumor and normal breast tissue samples analyzed.

Table S1. Characteristics of breast tumor and normal breast tissue samples. Relevant characteristics of breast tumor and normal breast tissue samples analyzed.
YUEMIN DING Neuro-oncology Group Department of Molecular Neuroscience

YUEMIN DING Neuro-oncology Group Department of Molecular Neuroscience
Supplemental figure1 89101112131415 Age (weeks) Up to 39 Systemic DMBA Tumor detection Collection A D C loxP AREx2-FAREx4-R Exon 4 Exon 2 Exon 3 Exon 2.

Supplemental figure Age (weeks) Up to 39 Systemic DMBA Tumor detection Collection A D C loxP AREx2-FAREx4-R Exon 4 Exon 2 Exon 3 Exon 2.
Age, SexHistologyPredominant subtype Pathological stage EGFR mutation CAF1 61, MaleAdenocarcinoma Solid predominant pT3N2M0 L858R CAF2 71, MaleAdenocarcinoma.

Age, SexHistologyPredominant subtype Pathological stage EGFR mutation CAF1 61, MaleAdenocarcinoma Solid predominant pT3N2M0 L858R CAF2 71, MaleAdenocarcinoma.
8.6 Gene Expression and Regulation TEKS 5C, 6C, 6D, 6E KEY CONCEPT Gene expression is carefully regulated in both prokaryotic and eukaryotic cells.

8.6 Gene Expression and Regulation TEKS 5C, 6C, 6D, 6E KEY CONCEPT Gene expression is carefully regulated in both prokaryotic and eukaryotic cells.
Supplementary table 1 Supplementary table 1. Clinical-pathological features of the resection-only and chemotherapy/resection stage II/III colorectal cancer.

Supplementary table 1 Supplementary table 1. Clinical-pathological features of the resection-only and chemotherapy/resection stage II/III colorectal cancer.
Supplementary table 1 miR-506 expression and clinocopathological factors FactorsTotal number miR-506 low expressionmiR-506 high expression P-value (n =

Supplementary table 1 miR-506 expression and clinocopathological factors FactorsTotal number miR-506 low expressionmiR-506 high expression P-value (n =
Complexities of Gene Expression Cells have regulated, complex systems –Not all genes are expressed in every cell –Many genes are not expressed all of.

Complexities of Gene Expression Cells have regulated, complex systems –Not all genes are expressed in every cell –Many genes are not expressed all of.
Supplementary Figure Legends: Table 1. List of primers used for Real Time – PCR Supp Fig 1. S100A7-overexpressing MCF7 cells show decreased formation of.

Supplementary Figure Legends: Table 1. List of primers used for Real Time – PCR Supp Fig 1. S100A7-overexpressing MCF7 cells show decreased formation of.
Supplementary Table S1. Patient demographics of the RRBS discovery set. Characteristics RRBS discovery set TotalIDH1/2 WT IDH1 MUT No. of Patients311120.

Supplementary Table S1. Patient demographics of the RRBS discovery set. Characteristics RRBS discovery set TotalIDH1/2 WT IDH1 MUT No. of Patients
Oligo sequence for shRNA cloning TurboGFP shRNA upper strand CCGGCGTGATCTTCACCGACAAGATCTCGAGATCTTGTC GGTGAAGATCACGTTTTT TurboGFP shRNA bottom strand AATTAAAAACGTGATCTTCACCGACAAGATCTCGAGATC.

Oligo sequence for shRNA cloning TurboGFP shRNA upper strand CCGGCGTGATCTTCACCGACAAGATCTCGAGATCTTGTC GGTGAAGATCACGTTTTT TurboGFP shRNA bottom strand AATTAAAAACGTGATCTTCACCGACAAGATCTCGAGATC.
MRNASeq analysis using TCGA HNSC data Vinay Kartha Monti lab rotation project 11/25/2013.

MRNASeq analysis using TCGA HNSC data Vinay Kartha Monti lab rotation project 11/25/2013.
Supplementary Table 1: Clinicopathologic characteristics of 100 patients with invasive breast cancer Clinical characteristicsNumber of cases (%) Median.

Supplementary Table 1: Clinicopathologic characteristics of 100 patients with invasive breast cancer Clinical characteristicsNumber of cases (%) Median.
Supplementary Fig. 1. RT-PCR showed that tumor tissues have elevated Mst1 mRNA levels in most of the HCC patients tested. GAPDH RT-PCR products were shown.

Supplementary Fig. 1. RT-PCR showed that tumor tissues have elevated Mst1 mRNA levels in most of the HCC patients tested. GAPDH RT-PCR products were shown.

Similar presentations

Ads by Google