1. Lipid Bilayer Phospholipids make up the outer layer of all cells

2. Fluid Mosaic Model Fluid: all components move around freely Mosaic: many different types of proteins on the surface make a mosaic pattern

3. Membrane Proteins Cell Proteins serve many different purposes

4. Diffusion

6. Facilitative Diffusion

7. Active Transport

8. Osmosis

10. Endocytosis Exocytosis Pinocytosis

11. Animal Cell

12. DNA Base Pairs: A – T C – G Bases/Base Pairs Nucleotides 3. Nitrogenous Base 1. 2. (deoxyribonucleic acid)

13. DNA Organization Chromatin organized: DNA Histones One Duplicated Chromosome

14. Human Chromosomes A Pair of Duplicated Chromosomes Autosomes 46 individual chromosomes / 23 pairs of chromosomes they are the same - code for same type of trait they are different - code for different version of trait Sex Chromosomes

15. Understanding the Numbers 1 chromosome is 1 large DNA molecule a gene is a specific sequence of nucleotides ATTCCGTAGCTGATCGTAAAGGG 1000-5000 genes per chromosome 30,000-100,000 genes per human genome

16. DNA Functions Pass on Genetic Material Replication Mitosis Meiosis Protein Synthesis Transcription Translation

17. Replication Making an exact copy of DNA Occurs just prior to cell division Double helix unwinds DNA polymerase adds bases Two exact copies are made

18. Protein Synthesis Transcription DNA to mRNA Translation mRNA to Protein

19. From Gene to Protein DNA RNA Protein

20. Genetic Code Codons three base code Code for specific amino acids

21. Point Mutation Spontaneous Mutation Environmental Insult Mutagenesis Carcinogenesis Mutation is corrected

22. Point Mutation Mutation is not corrected Mutation is corrected

23. Two-Hit Hypothesis Born with 2 genes or alleles for any given disease: one from mom one from dad If one is bad, this increases your chance of getting the disease

24. Animal Tissues Epithelial Tissue Connective Tissue Muscular Tissue Nervous Tissue

25. Epithelial Tissue Function filtration lubrication secretion Classification simple stratified squamous cuboidal columnar

26. Simple Epithelial Tissue Squamous Cuboidal Columnar

27. Stratified Squamous Epithelium

28. Connective Tissue Function binds together tissues and organs supports tissues and organs strengthens other tissues and organs protects other tissues and organs insulates other tissues and organs Composed of cells matrix ground substance fibers (collagen, elastic, reticular)

29. Connective Tissue Loose Connective Tissue Dense, Irregular Connective Tissue Dense, Regular Connective Tissue

30. Cartilage Bone Adipose Tissue

31. Muscle Tissue Function provides organismic or organ movement organismic posture thermogenic Classification skeletal smooth cardiac

32. Muscle Tissue Skeletal Muscle Tissue Smooth Muscle Tissue Cardiac Muscle Tissue

33. Nervous Tissue Function converts environmental and internal stimuli into nerve impulses stimulates or inhibits cells or glands Classification neurons neuroglia (glia)

34. Neuron

35. Organ Systems