2. Ch. 12.4 Mutations Section Objectives: Categorize the different kinds of mutations that can occur in DNA. Compare the effects of different kinds of mutations on cells and organisms.

3. Mutations Any change in DNA sequence is called a mutation. can be caused by errors in replication, transcription, cell division, or by external agents. If mutation occurs in gametes (sex cells) it will be passed on to offspring may produce a new trait or it may result in a protein that does not work correctly. the mutation results in a protein that is nonfunctional, and the embryo may not survive In some rare cases a gene mutation may have positive effects.

4. Mutations If mutation takes place in a body cell, it is not passed on to organism’s offspring – Damage to a gene may impair the function of the cell – When that cell divides, the new cells also will have the same mutation – Some mutations of DNA in body cells affect genes that control cell division. – This can result in the cells growing and dividing rapidly, producing cancer.

5. Characteristics of Mutations One of the main sources of genetic variation. – Unique traits are thought to originate through mutations that are passed on Occur at random sometimes a mistake in base pairing during DNA replication. many mutations are caused by factors in the environment Can be classified as either: – Gene Mutations – Chromosomal Mutations

6. Gene Mutations Changes that affect the nucleotide sequence of a gene – change the DNA – changes the mRNA – may change protein – may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa protein trait

7. Types of gene mutations Changes to the letters (A,C,T,G bases) in the DNA – point mutation change to ONE letter (base) in the DNA may cause change to protein, may not – frameshift mutation addition of a new letter (base) in the DNA sequence deletion of a letter (base) in the DNA both of these shift the DNA so it changes how the codons are read big changes to protein!

8. Point Mutations One base change – can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCARANDTHEREDRATRAN THEFATCATENDTHEREDRATRAN OR

9. Point Mutations Substitution mutation = may change amino acid AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop

10. Sickle cell anemia- a single substitution Hemoglobin protein in red blood cells – strikes 1 out of 400 African Americans – limits activity, painful & may die young

11. Sickle Cell Anemia- substitution Does convey resistance to malarial infections when heterozygous

12. Point Mutations Substitution mutation = may be no change to protein AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGCUUGCGAGUGA MetArgValTyrAlaCysGluStop

13. Point Mutations Substitution mutation = may change to STOP AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUAAGCAUGCGAGUGA MetArgValStop

14. Frameshift Mutations Add or delete one or more bases – changes the meaning of the whole protein as it changes how the mRNA codons are read. This change causes all remaining codons to be incorrectly grouped. The change in “reading frame” causes all resulting proteins to be made improperly. THEFATCATANDTHEREDRATRAN THEFATCANTANDTHEREDRATRAN THEFATCAANDTHEREDRATRAN OR

16. Frameshift Mutations Insertion = add one or more bases- AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA

17. Frameshift Mutations Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA

18. Chromosome mutations Chromosome mutations- changes in the structure of a chromosome or the loss of a chromosome. Often occur during cell division. – Deletion- loss of a piece of a chromosome due to breakage. Information carried by the missing piece is lost. – Inversion- a chromosomal segment breaks off and reattaches in the reverse orientation on the same chromosome.

19. Chromosome mutations cont. – Translocation- a chromosomal segment breaks off and attaches to another, non-homologous chromosome. – Nondisjunction- results from the failure of a chromosome to separate from its homologue during meiosis. During nondisjunction, one gamete receives an extra copy, and the other gamete is missing the chromosome entirely.

21. Patterns of Inheritance Nondisjunction- failure of the chromosomes to separate correctly during cell division. – Monosomy- and individual is missing one of a pair of particular chromosomes (the total number would be 45 for humans) Turner syndrome- individual only has 1 X chromosome; results in a female with immature physical development, sterility, and a webbed neck.

22. Chromosomes Don’t Separate Properly during Meiosis

23. Nondisjunction Also Can Change the Number of Sex Chromosomes Turner syndrome – Missing an X chromosome; XO – Female; webbed neck; no secondary sexual traits at puberty; sterile; may age prematurely XXX females – Develop normally

24. Turner Syndrome

25. Nondisjunctions cont. Trisomy- an individual has 3 of a particular chromosome. (total number would be 47 for humans) – Down syndrome- extra chromosome at number 21- individual has mental deficiencies, folded skin above the eyes, weak muscles – Kleinfelter’s syndrome- genotype XXY male- has mental retardation, and low fertility.

26. In Down Syndrome There Are Three Copies of Chromosome 21

27. Nondisjunction Also Can Change the Number of Sex Chromosomes Klinefelter syndrome (XXY) – Low fertility; mental retardation; small testes; sparse body hair; enlarged breasts – Testosterone injections may reverse the phenotype XYY condition – Taller – Normal male phenotype

28. Kleinfelter’s Syndrome

29. Induced Mutations Mutagen- environmental factor that damages DNA. – Sunlight (UV light) causing skin cancer. – Radiation causing infertility or cancer – X-rays – Chemicals like pesticides and herbicides – Nuclear Radiation – Asbestos – Formaldehyde – Pathogens- frogs with extra legs