1. pUC 19 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ PCR -I pUC 19 specific primers Amplicon purification PCR -II 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ Composite pUC 19 primers with overhangs of Tri6 primers at 5’ ends 236 bp 280 bp IAC Amplicon purification 5’ 3’ 5’ 3’ Figure S1. Schematic representation of construction of Internal Amplification Control (IAC) gene by Composite Primer technique. In the step PCR-I, a 236 bp amplicon was amplified from pUC 19 plasmid using the plasmid specific primers. The amplicon was purified and later subjected to PCR-II using modified primers that were essentially same primers used in PCR-I, but with Tri6 gene primer sequence-overhangs at 5’ ends. The resulting amplicon (280 bp) was purified and serially diluted to be used as IAC. The PCRs were performed in Mastercycler Pro thermalcycler (Eppendorf, Germany) in a 20 µl reaction mix containing 50 ng template DNA, 1X PCR buffer (with 1.5 mM MgCl 2 ), 100 µM each dNTP, 1µM each primer and 1 unit Taq polymerase (Fermentas, New Delhi, India). PCR amplicons were purified by Genelute PCR clean-up kit, Sigma, India. Figure S1. PCR – II conditions: Initial Denaturation: 94 °C for 3 min Denaturation: 94 °C for 30 s Annealing: 56 °C for 30 s Extension: 72 °C for 30 s Final extension: 72 °C for 4 min PCR – I conditions: Initial Denaturation: 94 °C for 3 min Denaturation: 94 °C for 30 s Annealing: 56 °C for 30 s Extension: 72 °C for 30 s Final extension: 72 °C for 4 min

2. PCR-I amplified pUC 19 sequence (236 bp): acatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaaga acgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcc cgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatg acttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagt aagagaattatgcagt PCR-II amplified pUC 19 sequence with Tri6 primer overhangs (280 bp): GATCTAAACGACTATGAATCACCacatcgaactggatctcaacagcggtaagatc cttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttc tgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcg ccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaag catcttacggatggcatgacagtaagagaattatgcagtACATGCGAGATCACTA TAGGC pUC 19 primers sequences were colored in red. Tri6 overhangs were capitalized and colored in green. Data S1:

3. Fig S2. Figure S2: Detection of predominant amplicon in the optimized mPCR assay. The mPCR products were electrophoresed in 1.2% agarose gel, stained with ethidium bromide, documented (G-Box, Syngene, India) and electropherograms were constructed by GeneSys image acquisition software (Genetools, Syngene, India). The raw volume of fluorescent peaks analyzed by Genetools software were plotted on top of the peaks. Tri6 gene product was found to amplify efficiently than other genes.

4. Figure S3. Robustness of the developed mPCR. Three replicates of the multiplex PCR constituents were prepared with varied PCR buffer concentrations (0.8X – lanes 1, 4, 7; 1X – lanes 2, 5, 8; 1.2X – lanes 3, 6, 9) and were subjected to PCR at gradient temperatures 56 °C, 58 °C and 60 °C. The PCR amplicons were electrophoresed in 1.2% agarose agel,stained with ethidium bromide and visualized under UV transillumination (G-box, Syngene, India). Figure S3.