Download presentation
Published byAsher Skinner Modified over 8 years ago
1
Development of Tetra-Primer ARMS-PCR for Hemoglobin E Detection
Jatuphol Pholtaisong Biological Science Program Department of Biology, Faculty of Science, Naresuan University Advisor: Dr.Lt.Saisiri Mirasena Co-Advisors: Asst.Prof.Dr.Maliwan Nakkuntod and Dr.Phrutthinun Surit
2
Hemoglobin E Abnormal Hemoglobin
-globin gene Codon 26 (GAG-AAG) Glu-Lys Alternative splicing => reduced mRNA Mildly unstable (sensitive to oxidants) Beta thalassemia/Hemoglobin E => Mild to Severe Lower Northern Part of Thailand (Rawangkran et al.,2013) - Homozygous HbE 5.05% - Heterozygous HbE 42.09%
3
Hemoglobin E Detections
Screening Tests - Dichlorophenol indophenol (DCIP) - High-Performance Liquid Chromatography (HPLC) Confirmation Tests - Reverse Dot-Blot Hybridization - Amplification Refractory Mutation System–PCR (ARMS-PCR)
4
Amplification Refractory Mutation System–PCR (ARMS-PCR)
Reaction 1 Normal Allele Detection Reaction 2 Mutant Allele Detection Forward Primer 5’ ’ Forward Primer Forward Primer 5’ ’ 5’ ’ Reverse Primer (Normal) 3’ C ’ Reverse Primer (Normal) Reverse Primer (Mutant) Reverse Primer (Mutant) 3’ C ’ 3’ T ’ 3’ T ’
5
Amplification Refractory Mutation System–PCR (ARMS-PCR) Interpretation
1 (N) 2 (M) 1 (N) 2 (M) 1 (N) 2 (M) Normal Heterozygous HbE Homozygous HbE
6
Amplification Refractory Mutation System–PCR (ARMS-PCR) Interpretation
1 (N) 2 (M) 1 (N) 2 (M) 1 (N) 2 (M) Internal Control > Normal Heterozygous HbE Homozygous HbE
7
Tetra-primer ARMS-PCR Principle
Ye et al. (2001)
8
Primer Mismatch at 3’-end
5’ G 3’ 3’C ’ 5’ G 3’ 3’T ’ Mismatch
9
Weak Primer Mismatch at 3’-end
5’ G 3’ 3’C ’ 5’ G 3’ 3’T ’ Weak Mismatch
10
Type of Primer Mismatch
Strong Mismatch G/A C/T Medium Mismatch A/A C/C G/G T/T Weak Mismatch C/A G/T > Add secondary mismatch at position –2 from the 3’-terminus to increase specificity Ye et al. (2001)
11
Study Steps Primer Design PCR Optimization Compare with ARMS-PCR
12
Tetra-primer ARMS-PCR Principle
Ye et al. (2001)
13
Materials and Methods: Primer Design
PRIMER1: primer design for tetra-primer ARMS-PCR (Ye et al., 2001) OligoCalc (Kibbe, 2007) OligoAnalyzer 3.1 ( GenBank ( Primers Sequences TM (ºC) Position Product size HbE-OF CCC TTC CTA TGA CAT GAA CTT AAC CAT A 65.6 (NC_ ) 691 HbE-OR GGC TGT CAT CAC TTA GAC CTC AC 64.6 (NC_ ) HbE-IF(Normal) ACCAACCTGCCCAGGGCATC (NC_ ) 276 HbE-IR(Mutant) GTGAACGTGGATGAAGTTGGTGTTA 64.1 (NC_ ) 462
14
Study Steps Primer Design PCR Optimization Compare with ARMS-PCR
15
PCR Optimization: HbE Samples
16
PCR Optimization: HbE Samples
17
PCR Optimization: HbE Samples
18
PCR Optimization Primer Concentration Annealing Temperature
0.2 µM Each Primer 0.2 µM OF/OR Primer, 0.4 µM IF/IR Primer Annealing Temperature Normal Annealing Temperature (60ºC 35 cycles) Touchdown PCR - 70ºc (-1ºc/cycle) 10 cycles - 60ºc 25 cycles
19
Results: PCR Optimization
0.2 µM Each Primer Normal Annealing Temperature (60ºC 35 cycles) M: Marker 1: Normal 2: Heterozygous Hb E 3: Homozygous HbE 4: Negative
20
Results: PCR Optimization
0.2 µM OF/OR Primer, 0.4 µM IF/IR Primer 0.2 µM Each Primer Normal Annealing Temperature (60ºC 35 cycles) M: Marker 1: Normal 2: Heterozygous Hb E 3: Homozygous HbE 4: Negative
21
Results: PCR Optimization
0.2 µM OF/OR Primer, 0.4 µM IF/IR Primer 0.2 µM Each Primer Normal Annealing Temperature (60ºC 35 cycles) Touchdown PCR - 70ºc (-1ºc/cycle) 10 cycles - 60ºc 25 cycles M: Marker 1: Normal 2: Heterozygous Hb E 3: Homozygous HbE 4: Negative
22
Results: PCR Optimization
0.2 µM OF/OR Primer, 0.4 µM IF/IR Primer 0.2 µM Each Primer Normal Annealing Temperature (60ºC 35 cycles) Touchdown PCR - 70ºc (-1ºc/cycle) 10 cycles - 60ºc 25 cycles M: Marker 1: Normal 2: Heterozygous Hb E 3: Homozygous HbE 4: Negative
23
Results: PCR Optimization
0.2 µM OF/OR Primer, 0.4 µM IF/IR Primer 0.2 µM Each Primer Normal Annealing Temperature (60ºC 35 cycles) Touchdown PCR - 70ºc (-1ºc/cycle) 10 cycles - 60ºc 25 cycles M: Marker 1: Normal 2: Heterozygous Hb E 3: Homozygous HbE 4: Negative
24
Results: PCR Ingredients
PCR Ingredients (total volume 20 µL) 1X PCR Buffer (NanoHelix, Korea) 0.2 mM Each DNTPs (NanoHelix, Korea) 1 Unit HelixAmpTM Ab+ Taq DNA polymerase (NanoHelix, Korea) 0.2 µM HbE-OF Primer, 0.2 µM HbE-OR Primer 0.3 µM HbE-IF Primer, 0.3 µM HbE-IR Primer DNA Template 3 µL
25
Results: PCR Cycles Pre-Denaturation 95ºc 2m Denaturation 97ºc 30s
Annealing 70ºc (-1ºc/cycle) 30s Extension 72ºc 1m 25 cycles 60ºc 30s Final Extension 72ºc 5m
26
Methods: Step by Step Primer Design PCR Optimization
Compare with ARMS-PCR
27
Results: Tetra Primer ARMS-PCR and ARMS-PCR Comparison
Known Samples: Normal 20 Samples Heterozygous Hb E 16 Samples Homozygous Hb E 20 Samples E E EE E N N E EE EE E E -
28
Discussions and Conclusions
Tetra-Primer ARMS-PCR for Hemoglobin E Detection was successfully developed. This technique required touchdown PCR and higher inner primer concentrations. When compared with standard technique in 48 known samples, the results were concordant. This technique is efficient, less time-consuming and safe cost for hemoglobin E gene detection.
29
References Rawangkran, A., Janwithee, N., Wong, P., & Jermnim, N. (2013). Prevalence of Thalassemia Trait from Screening Program in Pregnant Women in the Lower Northern Region of Thailand. Thai Journal of Genetics, S(1), Ye, S., Dhillon, S., Ke, X., Collins, A. R., & Day, I. N. (2001). An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Research, 29(17), E doi: /nar/29.17.e88.
30
Acknowledgments
31
T G
Similar presentations
© 2024 SlidePlayer.com. Inc.
All rights reserved.