Presentation is loading. Please wait.

Presentation is loading. Please wait.

454 Genome Sequence Assembly and Analysis HC70AL S09 04-13-09 Brandon Le & Min Chen.

Published byDale York Modified over 8 years ago

Similar presentations

Presentation on theme: "454 Genome Sequence Assembly and Analysis HC70AL S09 04-13-09 Brandon Le & Min Chen."— Presentation transcript:

1 454 Genome Sequence Assembly and Analysis HC70AL S09 04-13-09 Brandon Le & Min Chen

2 Shotgun Genome Sequencing original DNA 454 Sequencing Sequence Analysis Begins!!! fragmented DNA REPEAT 1

3 Genome Sequence Analysis - Step One Assemble Sequences into Contigs Sequenced fragmented DNA AAACGCGATCGATCGATCGA AAACGCGATCGATCGATCGATCGATCGATCGAT CGTAG CGATCGATCGATCGATCGTAG AAACGCGATCGATCGATCGA Assembled DNA Sequence CONTIG 1CONTIG 2CONTIG 3

4 Genome Sequence Analysis - Step One Initial Problem with Assembly Sequenced fragmented DNA Incorrectly Assembled DNA Sequence CONTIG 1 CONTIG 2

5 Genome Sequence Analysis - Step One Need to Mask Repeats Sequenced fragmented DNA Masked DNA Sequence CONTIG 1 CONTIG 3 CONTIG 5 CONTIG 2 CONTIG 4 Assembled DNA Sequence

6 Genome Sequence Analysis - Step Two Determine Open Reading Frame CONTIG 1 CONTIG 3 CONTIG 5 CONTIG 2 CONTIG 4 Assembled DNA Sequence GENE 1 GENE 2 Identify ORF

Download ppt "454 Genome Sequence Assembly and Analysis HC70AL S09 04-13-09 Brandon Le & Min Chen."

Similar presentations

Genome Projects A genome project is the complete DNA sequence of the genome of an organism, and the identification of all its genes Genome projects are.

Genome Projects A genome project is the complete DNA sequence of the genome of an organism, and the identification of all its genes Genome projects are.
Suppl. Fig. 1 d) LG-RCA-b1-re) L2-RCA-A3-r c) betasatellite f) 9S1-RCA-a6-r a) DNA-Ab) alphasatellite Fig. 7. Genome maps of unusual or novel circular.

Suppl. Fig. 1 d) LG-RCA-b1-re) L2-RCA-A3-r c) betasatellite f) 9S1-RCA-a6-r a) DNA-Ab) alphasatellite Fig. 7. Genome maps of unusual or novel circular.
Annotating a Scarlet Runner Bean genome fragment put together by shotgun sequencing Scarlet Runner ean Max Bachour.

Annotating a Scarlet Runner Bean genome fragment put together by shotgun sequencing Scarlet Runner ean Max Bachour.
Max BachourJessica Chen. Shotgun or 454 sequencing High throughput sequencing technique that can collect a large amount of data at a fast rate. Works.

Max BachourJessica Chen. Shotgun or 454 sequencing High throughput sequencing technique that can collect a large amount of data at a fast rate. Works.
SEQUENCING-related topics 1. chain-termination sequencing 2. the polymerase chain reaction (PCR) 3. cycle sequencing 4. large scale sequencing stefanie.hartmann.

SEQUENCING-related topics 1. chain-termination sequencing 2. the polymerase chain reaction (PCR) 3. cycle sequencing 4. large scale sequencing stefanie.hartmann.
Bioinformatics caacaagccaaaactcgtacaaCgagatatctcttggaaaaactgctcacaatattgacgtacaaggttgttcatgaaactttcggtaAcaatcgttgacattgcgacctaatacagcccagcaagcagaat Managing.

Bioinformatics caacaagccaaaactcgtacaaCgagatatctcttggaaaaactgctcacaatattgacgtacaaggttgttcatgaaactttcggtaAcaatcgttgacattgcgacctaatacagcccagcaagcagaat Managing.
Class 02: Whole genome sequencing. The seminal papers www.cs.arizona.edu/people/gene/#papers ``Is Whole Genome Sequencing Feasible?'' ``Whole-Genome DNA.

Class 02: Whole genome sequencing. The seminal papers ``Is Whole Genome Sequencing Feasible?'' ``Whole-Genome DNA.
BME 130 – Genomes Lecture 7 Genome Annotation I – Gene finding & function predictions.

BME 130 – Genomes Lecture 7 Genome Annotation I – Gene finding & function predictions.
Bio 465 Summary. Overview Conserved DNA Conserved DNA Drug Targets, TreeSAAP Drug Targets, TreeSAAP Next Generation Sequencing Next Generation Sequencing.

Bio 465 Summary. Overview Conserved DNA Conserved DNA Drug Targets, TreeSAAP Drug Targets, TreeSAAP Next Generation Sequencing Next Generation Sequencing.
3 September, 2004 Chapter 20 Methods: Nucleic Acids.

3 September, 2004 Chapter 20 Methods: Nucleic Acids.
Genome Assembly Charles Yan 2008. Fragment Assembly Given a large number of fragments, such as ACC AC AT AC AT GG …, the goal is to figure out the original.

Genome Assembly Charles Yan Fragment Assembly Given a large number of fragments, such as ACC AC AT AC AT GG …, the goal is to figure out the original.
Genome sequencing. Vocabulary Bac: Bacterial Artificial Chromosome: cloning vector for yeast Pac, cosmid, fosmid, plasmid: cloning vectors for E. coli.

Genome sequencing. Vocabulary Bac: Bacterial Artificial Chromosome: cloning vector for yeast Pac, cosmid, fosmid, plasmid: cloning vectors for E. coli.
Genome Assembly Bonnie Hurwitz Graduate student TMPL.

Genome Assembly Bonnie Hurwitz Graduate student TMPL.
Sequencing a genome (a) outline the steps involved in sequencing the genome of an organism; (b) outline how gene sequencing allows for genome-wide comparisons.

Sequencing a genome (a) outline the steps involved in sequencing the genome of an organism; (b) outline how gene sequencing allows for genome-wide comparisons.
DNA Sequencing. Fig. 17-13

DNA Sequencing. Fig
Chapter 6 Gene Prediction: Finding Genes in the Human Genome.

Chapter 6 Gene Prediction: Finding Genes in the Human Genome.
Lecture 15 – Gene Cloning Based on Chapter 08 - Genomics: The Mapping and Sequencing of Genomes Copyright © 2010 Pearson Education Inc.

Lecture 15 – Gene Cloning Based on Chapter 08 - Genomics: The Mapping and Sequencing of Genomes Copyright © 2010 Pearson Education Inc.
Presentation on genome sequencing. Genome: the complete set of gene of an organism Genome annotation: the process by which the genes, control sequences.

Presentation on genome sequencing. Genome: the complete set of gene of an organism Genome annotation: the process by which the genes, control sequences.
Fig. 12-1 Chapter 12: Genomics. Genomics: the study of whole-genome structure, organization, and function Structural genomics: the physical genome; whole.

Fig Chapter 12: Genomics. Genomics: the study of whole-genome structure, organization, and function Structural genomics: the physical genome; whole.
Genome sequencing Haixu Tang School of Informatics.

Genome sequencing Haixu Tang School of Informatics.

Similar presentations

Ads by Google