1. Unlocking the mystery of DNA

2. Cell division and DNA replication Cells divide Growth, Repair, Replacement Before cells divide, they have to double cell structures, organelles and their genetic information

3. DNA replication – Mitosis & Meiosis

4. But… What did DNA look like, and how did it replicate itself?

5. Discovering the structure of DNA Rosalind Franklin (1920-1958) King’s College, London Made significant advances in x- ray diffraction (like bending of light) techniques with DNA Her images suggested that DNA had a spiral shape One of her DNA images

6. Discovering the structure of DNA James Watson (1928) and Francis Crick (1916-2004) Worked together to determine the structure of DNA Used work from Franklin, Wilkins, and Chargaff to determine the double helix shape Watson, Crick, and Wilkins were awarded the Nobel Prize Rosalind Franklin passed away (1958) before the Nobel Prize was awarded in 1962

7. Discovering the structure of DNA DNA = Deoxyribose nucleic acid Present in all living cells Contains all the information Nucleotides: a subunit that consists of: a sugar (deoxyribose) a phosphate and one nitrogen base – 4 different bases Adenine (A) and Thymine (T) Guanine (G) and Cytosine (C)

8. DNA – What does my code look like? Computer Code: 100101001110100011001010011100101111001 01001001001001011100101000101010010010 1001010100100101001010010101001010010 10010101010101001010100101010111111100 DNA Code: ATTCGGGGCCTTAAGACATTAATTTCCCAAG AAGAGATAAACTAGAGAGACCCTTTAAAACA CACAGAGATAGACAGAAAAACAATAGACAGA TACAGATAGACATAAAAAATTTTTTGGGAAA …millions and millions of bases…

9. Practice DNA Base Pairs

10. RNA *RNA (Ribonucleic acid) is a half copy of DNA *RNA is also made of nucleotides but has a different sugar. The sugar in RNA is ribose *RNA also has uracil in place of thymine

11. RNA single strand DNA double strand

12. Differences in RNA and DNA There are 3 main differences in RNA and DNA 1.DNA contains the sugar deoxyribose but RNA contains ribose 2.DNA contains thymine and RNA contains uracil 3.DNA is double stranded and RNA is single stranded.