1. Copyright OpenHelix. No use or reproduction without express written consent1

2. Materials prepared by: Sawsan Khuri, Ph.D. www.openhelix.com Updated: Q1 2011 Version 2.0 MEME Motif Discovery and Search Algorithm

3. Copyright OpenHelix. No use or reproduction without express written consent3 MEME Agenda Introduction and Credits Basic Searches Understanding the Results Summary Exercises MEME: http://meme.sdsc.edu/meme/cgi-bin/meme.cgi

4. Copyright OpenHelix. No use or reproduction without express written consent4 Introduction For detection of conserved motifs in DNA or protein sequences http://meme.sdsc.edu/meme/cgi-bin/meme.cgi

5. Copyright OpenHelix. No use or reproduction without express written consent5 MEME algorithm part of MEME Suite http://nar.oxfordjournals.org/cgi/content/full/37/suppl_2/W202 Motif-based sequence analysis tools Introductory tutorials available on: MEME Suite Overview MEME Algorithm GLAM2 Algorithm FIMO, MAST & GLAM2SCAN TOMTOM & GOMO Focus here

6. Copyright OpenHelix. No use or reproduction without express written consent6 Credits Contact, Documentation, FAQs, User Support & more http://www.sdsc.edu/~tbailey/papers/ismb94.pdf http://nar.oxfordjournals.org/cgi/content/full/34/suppl_2/W369

7. Copyright OpenHelix. No use or reproduction without express written consent7 MEME – Where to Start Expand menu for more options Submit A Job Documentation Downloads User Support

8. Copyright OpenHelix. No use or reproduction without express written consent8 MEME Agenda  Introduction and Credits  Basic Searches  Understanding the Results  Summary  Exercises MEME: http://meme.sdsc.edu/meme/cgi-bin/meme.cgi

9. Copyright OpenHelix. No use or reproduction without express written consent9 Input Sequences FASTA FORMAT: >GENE_1_ID and a few words accgtgggatggacgctgagctgacca aagctagatcgaatatagactagcatg atcggataga >GENE_2_ID and a few words atatagcagtcgggatggacgctgagc tgatagatcgatgctagtcgatagctg atgcta >GENE_3_ID and a few words atcgatggtgctgataacacgatgctg acgatgctagatcgatcgagcatggga tggacgctgagctgacatccgact ¶ ¶ Remember to save as a plain text file

10. Copyright OpenHelix. No use or reproduction without express written consent10 Required Parameters Motif occurrence Motif width Number of motifs

11. Copyright OpenHelix. No use or reproduction without express written consent11 Optional Parameters Description # of sites Provide ‘negative sequences’ for discriminative discovery Strand, palindromes

12. Copyright OpenHelix. No use or reproduction without express written consent12 Browser Result Display Job Running Email Result Display Dataset Stats Results Outputs

13. Copyright OpenHelix. No use or reproduction without express written consent13 MEME Agenda  Introduction and Credits  Basic Searches  Understanding the Results  Summary  Exercises MEME: http://meme.sdsc.edu/meme/cgi-bin/meme.cgi

14. Copyright OpenHelix. No use or reproduction without express written consent14 Email Result Display Confirmation Email MEME Sequences submitted

15. Copyright OpenHelix. No use or reproduction without express written consent15 MEME Results Page, Top Result Summary

16. Copyright OpenHelix. No use or reproduction without express written consent16 Understanding the Results – Motif 1, upper Download Motif

17. Copyright OpenHelix. No use or reproduction without express written consent17 Position of Motif 1 Motif location on sequences Additional motif reports

18. Copyright OpenHelix. No use or reproduction without express written consent18 Motifs Summary Diagram Summary Diagram: Location of motifs found on all input sequences

19. Copyright OpenHelix. No use or reproduction without express written consent19 Explanations Search parameters Explanation of results scroll

20. Copyright OpenHelix. No use or reproduction without express written consent20 MEME Agenda  Introduction and Credits  Basic Searches  Understanding the Results  Summary  Exercises MEME: http://meme.sdsc.edu/meme/cgi-bin/meme.cgi

21. Copyright OpenHelix. No use or reproduction without express written consent21 Motif 1 results Summary results Summary

22. Copyright OpenHelix. No use or reproduction without express written consent22 MEME Agenda  Introduction and Credits  Basic Searches  Understanding the Results  Summary  Exercises MEME: http://meme.sdsc.edu/meme/cgi-bin/meme.cgi

23. Copyright OpenHelix. No use or reproduction without express written consent23